Incidental Mutation 'R0124:Epb41l5'
ID53378
Institutional Source Beutler Lab
Gene Symbol Epb41l5
Ensembl Gene ENSMUSG00000026383
Gene Nameerythrocyte membrane protein band 4.1 like 5
SynonymsE230025E14Rik, 1700030C16Rik, Epb4.1l5, NBL5, Lulu1
MMRRC Submission 038409-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0124 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location119545037-119649000 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 119633640 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 64 (K64*)
Ref Sequence ENSEMBL: ENSMUSP00000140227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027632] [ENSMUST00000052404] [ENSMUST00000163147] [ENSMUST00000187194] [ENSMUST00000191046]
Predicted Effect probably null
Transcript: ENSMUST00000027632
AA Change: K64*
SMART Domains Protein: ENSMUSP00000027632
Gene: ENSMUSG00000026383
AA Change: K64*

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000052404
AA Change: K64*
SMART Domains Protein: ENSMUSP00000058966
Gene: ENSMUSG00000026383
AA Change: K64*

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
coiled coil region 482 512 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163147
AA Change: K64*
SMART Domains Protein: ENSMUSP00000128374
Gene: ENSMUSG00000026383
AA Change: K64*

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 420 429 N/A INTRINSIC
coiled coil region 490 520 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187194
AA Change: K64*
SMART Domains Protein: ENSMUSP00000139683
Gene: ENSMUSG00000026383
AA Change: K64*

DomainStartEndE-ValueType
Pfam:FERM_N 47 114 1.7e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189042
Predicted Effect probably null
Transcript: ENSMUST00000191046
AA Change: K64*
SMART Domains Protein: ENSMUSP00000140227
Gene: ENSMUSG00000026383
AA Change: K64*

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192036
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a number of different mutations exhibit prenatal lethality and mesodermal and epithelial-mesenchymal transition defects during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,674 T194A probably benign Het
Afap1 C T 5: 35,945,209 P82S probably damaging Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
B020004J07Rik A G 4: 101,835,373 *477Q probably null Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Casq1 C T 1: 172,210,425 V380M probably damaging Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Col4a2 A G 8: 11,408,871 probably benign Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
Scara3 A T 14: 65,931,221 S316T probably benign Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stau2 C T 1: 16,463,128 A61T probably damaging Het
Stx3 T C 19: 11,791,799 E54G possibly damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Swt1 A T 1: 151,391,529 C634S probably damaging Het
Syt6 A G 3: 103,587,526 Y269C probably damaging Het
Tfap2a G A 13: 40,717,411 probably benign Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in Epb41l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Epb41l5 APN 1 119567847 missense probably benign 0.03
IGL01983:Epb41l5 APN 1 119579084 splice site probably benign
IGL02085:Epb41l5 APN 1 119572856 missense probably benign
IGL02834:Epb41l5 APN 1 119623955 missense probably benign 0.22
IGL02975:Epb41l5 APN 1 119579081 splice site probably benign
IGL03001:Epb41l5 APN 1 119617644 missense probably damaging 1.00
IGL03331:Epb41l5 APN 1 119617419 missense probably damaging 1.00
R0096:Epb41l5 UTSW 1 119623911 splice site probably benign
R0128:Epb41l5 UTSW 1 119549902 missense possibly damaging 0.81
R0130:Epb41l5 UTSW 1 119549902 missense possibly damaging 0.81
R0241:Epb41l5 UTSW 1 119567779 splice site probably null
R0357:Epb41l5 UTSW 1 119609204 missense probably damaging 1.00
R0624:Epb41l5 UTSW 1 119623958 missense probably damaging 1.00
R0711:Epb41l5 UTSW 1 119623911 splice site probably benign
R0848:Epb41l5 UTSW 1 119549954 missense probably benign 0.01
R1340:Epb41l5 UTSW 1 119549131 makesense probably null
R1401:Epb41l5 UTSW 1 119578904 splice site probably benign
R1416:Epb41l5 UTSW 1 119549876 splice site probably benign
R1452:Epb41l5 UTSW 1 119549166 missense probably damaging 1.00
R1646:Epb41l5 UTSW 1 119550022 splice site probably benign
R1889:Epb41l5 UTSW 1 119549172 missense possibly damaging 0.82
R1895:Epb41l5 UTSW 1 119549172 missense possibly damaging 0.82
R3082:Epb41l5 UTSW 1 119609262 missense probably damaging 1.00
R3742:Epb41l5 UTSW 1 119605243 missense probably benign
R4194:Epb41l5 UTSW 1 119608093 missense probably damaging 1.00
R4787:Epb41l5 UTSW 1 119595995 missense probably benign 0.00
R4983:Epb41l5 UTSW 1 119555071 missense probably benign 0.00
R6825:Epb41l5 UTSW 1 119620201 missense possibly damaging 0.54
R6943:Epb41l5 UTSW 1 119609129 missense probably damaging 1.00
R6944:Epb41l5 UTSW 1 119609129 missense probably damaging 1.00
R7334:Epb41l5 UTSW 1 119623949 missense probably damaging 1.00
R8553:Epb41l5 UTSW 1 119549941 missense possibly damaging 0.88
R8904:Epb41l5 UTSW 1 119620206 missense probably damaging 1.00
R8955:Epb41l5 UTSW 1 119642562 missense probably damaging 1.00
Z1177:Epb41l5 UTSW 1 119609211 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCCATGATCTGAAATTTGCCACTTCT -3'
(R):5'- TGCAACGAGCTAAATGAAGCAGTCATA -3'

Sequencing Primer
(F):5'- TGCAGTCATAATCGAACTTCCAAAAG -3'
(R):5'- TAGGGCAGTGACCCTACTGAAA -3'
Posted On2013-06-26