Incidental Mutation 'R6811:Gm19965'
ID533786
Institutional Source Beutler Lab
Gene Symbol Gm19965
Ensembl Gene ENSMUSG00000094429
Gene Namepredicted gene, 19965
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6811 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location116802983-116823410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 116804079 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 38 (L38F)
Ref Sequence ENSEMBL: ENSMUSP00000137019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179777]
Predicted Effect probably damaging
Transcript: ENSMUST00000179777
AA Change: L38F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137019
Gene: ENSMUSG00000094429
AA Change: L38F

DomainStartEndE-ValueType
KRAB 8 68 1.5e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,529,361 S69P probably damaging Het
Alkbh7 G T 17: 56,997,392 R10L probably benign Het
Ano3 T C 2: 110,880,867 E84G probably benign Het
Asxl3 A G 18: 22,522,911 E1326G possibly damaging Het
Atrnl1 T G 19: 57,654,961 M427R probably damaging Het
Cenpf T C 1: 189,654,542 E1847G probably benign Het
Csf1r T C 18: 61,119,053 Y536H probably damaging Het
Dnm3 T C 1: 162,321,083 K240E probably damaging Het
Dsc1 T G 18: 20,089,654 E587A probably benign Het
Gm16486 T C 8: 70,716,773 S1171P probably benign Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Helz T C 11: 107,619,318 probably null Het
Herc2 C T 7: 56,113,433 R929* probably null Het
Krt31 A G 11: 100,048,416 L225P probably damaging Het
Lrp1b T C 2: 40,715,500 probably null Het
Lrp1b A G 2: 41,449,194 V765A probably benign Het
Lsm5 A G 6: 56,702,142 I34T possibly damaging Het
Ly6g6c T C 17: 35,069,410 L86P probably damaging Het
Megf11 A G 9: 64,544,641 T116A probably damaging Het
Megf6 T C 4: 154,252,161 C190R probably damaging Het
Mroh9 A G 1: 163,046,041 V515A possibly damaging Het
Mtbp C A 15: 55,606,546 probably null Het
Myo9b T A 8: 71,356,578 F1810L probably damaging Het
Nacad T G 11: 6,599,400 K180Q possibly damaging Het
Ncf2 G A 1: 152,836,040 V502I probably benign Het
Npsr1 T A 9: 24,134,809 C75S probably benign Het
Oog3 T C 4: 144,159,582 T149A probably benign Het
Pank1 T A 19: 34,841,022 Q39L probably benign Het
Pdx1 T C 5: 147,274,664 S232P possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pirb A T 7: 3,719,642 V117E possibly damaging Het
Ppl G A 16: 5,089,144 L1096F probably damaging Het
Rev3l T A 10: 39,830,921 Y2223* probably null Het
Slc16a4 A G 3: 107,298,917 Y101C probably benign Het
Slc17a3 A T 13: 23,855,941 I321F possibly damaging Het
Sufu T A 19: 46,449,878 D168E probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tldc1 A T 8: 119,768,290 I243N possibly damaging Het
Vmn1r237 T G 17: 21,314,386 S124A probably benign Het
Vmn2r60 T A 7: 42,194,886 C558S probably damaging Het
Vwa5b1 G A 4: 138,592,103 T414I probably benign Het
Zfp651 T C 9: 121,766,529 S573P probably damaging Het
Zfp971 T G 2: 178,033,881 C424W possibly damaging Het
Other mutations in Gm19965
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0993:Gm19965 UTSW 1 116821825 missense probably benign 0.04
R1016:Gm19965 UTSW 1 116821301 nonsense probably null
R1173:Gm19965 UTSW 1 116820820 splice site probably benign
R1175:Gm19965 UTSW 1 116820820 splice site probably benign
R1335:Gm19965 UTSW 1 116804619 missense possibly damaging 0.79
R1773:Gm19965 UTSW 1 116821259 nonsense probably null
R1802:Gm19965 UTSW 1 116820903 nonsense probably null
R2884:Gm19965 UTSW 1 116821583 missense probably benign 0.14
R3435:Gm19965 UTSW 1 116821623 missense possibly damaging 0.78
R4072:Gm19965 UTSW 1 116821071 missense probably benign 0.17
R4585:Gm19965 UTSW 1 116821778 missense probably benign 0.00
R4801:Gm19965 UTSW 1 116821896 missense probably benign
R4802:Gm19965 UTSW 1 116821896 missense probably benign
R5328:Gm19965 UTSW 1 116821418 missense possibly damaging 0.78
R5856:Gm19965 UTSW 1 116821849 missense probably benign
R5960:Gm19965 UTSW 1 116821471 missense possibly damaging 0.67
R6185:Gm19965 UTSW 1 116821273 missense possibly damaging 0.61
R6297:Gm19965 UTSW 1 116822680 missense possibly damaging 0.82
R6374:Gm19965 UTSW 1 116822291 missense probably benign 0.06
R6860:Gm19965 UTSW 1 116820879 missense probably benign 0.19
R7076:Gm19965 UTSW 1 116821275 missense
R7162:Gm19965 UTSW 1 116822365 missense unknown
R7290:Gm19965 UTSW 1 116821191 missense
R7473:Gm19965 UTSW 1 116821872 missense unknown
R7643:Gm19965 UTSW 1 116822229 missense unknown
R7919:Gm19965 UTSW 1 116822120 nonsense probably null
R8187:Gm19965 UTSW 1 116821802 nonsense probably null
R8306:Gm19965 UTSW 1 116821785 missense
R8477:Gm19965 UTSW 1 116803124 start gained probably benign
R8751:Gm19965 UTSW 1 116822137 missense unknown
R8876:Gm19965 UTSW 1 116822046 missense unknown
Z1088:Gm19965 UTSW 1 116804600 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AAATGTGGCCAATATCAGCATG -3'
(R):5'- CCAACATGTTTTAGAGTCTCCATACTG -3'

Sequencing Primer
(F):5'- CTGATCAGAGAAATGACAGCATTC -3'
(R):5'- CAACAGACTGCCTTTTCAAAAAG -3'
Posted On2018-09-12