Incidental Mutation 'R6811:Ncf2'
ID533787
Institutional Source Beutler Lab
Gene Symbol Ncf2
Ensembl Gene ENSMUSG00000026480
Gene Nameneutrophil cytosolic factor 2
SynonymsNOXA2, p67phox, Ncf-2, NADPH oxidase subunit (67kDa)
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6811 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location152800194-152836991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 152836040 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 502 (V502I)
Ref Sequence ENSEMBL: ENSMUSP00000140404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027754] [ENSMUST00000043560] [ENSMUST00000073441] [ENSMUST00000111836] [ENSMUST00000186568]
Predicted Effect probably benign
Transcript: ENSMUST00000027754
AA Change: V502I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027754
Gene: ENSMUSG00000026480
AA Change: V502I

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043560
SMART Domains Protein: ENSMUSP00000041241
Gene: ENSMUSG00000042772

DomainStartEndE-ValueType
Pfam:EST1 63 177 3.4e-30 PFAM
Pfam:EST1_DNA_bind 179 438 3.3e-64 PFAM
low complexity region 457 465 N/A INTRINSIC
low complexity region 615 633 N/A INTRINSIC
low complexity region 682 710 N/A INTRINSIC
low complexity region 711 729 N/A INTRINSIC
low complexity region 874 898 N/A INTRINSIC
low complexity region 906 922 N/A INTRINSIC
low complexity region 931 947 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073441
SMART Domains Protein: ENSMUSP00000073144
Gene: ENSMUSG00000042772

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.6e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 653 671 N/A INTRINSIC
low complexity region 720 748 N/A INTRINSIC
low complexity region 749 767 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 996 1022 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111836
SMART Domains Protein: ENSMUSP00000107467
Gene: ENSMUSG00000042772

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.7e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
low complexity region 674 702 N/A INTRINSIC
low complexity region 703 721 N/A INTRINSIC
low complexity region 866 890 N/A INTRINSIC
low complexity region 898 914 N/A INTRINSIC
low complexity region 923 939 N/A INTRINSIC
low complexity region 1000 1026 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186568
AA Change: V502I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140404
Gene: ENSMUSG00000026480
AA Change: V502I

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes neutrophil cytosolic factor 2, the 67-kilodalton cytosolic subunit of the multi-protein NADPH oxidase complex found in neutrophils. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in this gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,529,361 S69P probably damaging Het
Alkbh7 G T 17: 56,997,392 R10L probably benign Het
Ano3 T C 2: 110,880,867 E84G probably benign Het
Asxl3 A G 18: 22,522,911 E1326G possibly damaging Het
Atrnl1 T G 19: 57,654,961 M427R probably damaging Het
Cenpf T C 1: 189,654,542 E1847G probably benign Het
Csf1r T C 18: 61,119,053 Y536H probably damaging Het
Dnm3 T C 1: 162,321,083 K240E probably damaging Het
Dsc1 T G 18: 20,089,654 E587A probably benign Het
Gm16486 T C 8: 70,716,773 S1171P probably benign Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm19965 G T 1: 116,804,079 L38F probably damaging Het
Helz T C 11: 107,619,318 probably null Het
Herc2 C T 7: 56,113,433 R929* probably null Het
Krt31 A G 11: 100,048,416 L225P probably damaging Het
Lrp1b T C 2: 40,715,500 probably null Het
Lrp1b A G 2: 41,449,194 V765A probably benign Het
Lsm5 A G 6: 56,702,142 I34T possibly damaging Het
Ly6g6c T C 17: 35,069,410 L86P probably damaging Het
Megf11 A G 9: 64,544,641 T116A probably damaging Het
Megf6 T C 4: 154,252,161 C190R probably damaging Het
Mroh9 A G 1: 163,046,041 V515A possibly damaging Het
Mtbp C A 15: 55,606,546 probably null Het
Myo9b T A 8: 71,356,578 F1810L probably damaging Het
Nacad T G 11: 6,599,400 K180Q possibly damaging Het
Npsr1 T A 9: 24,134,809 C75S probably benign Het
Oog3 T C 4: 144,159,582 T149A probably benign Het
Pank1 T A 19: 34,841,022 Q39L probably benign Het
Pdx1 T C 5: 147,274,664 S232P possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pirb A T 7: 3,719,642 V117E possibly damaging Het
Ppl G A 16: 5,089,144 L1096F probably damaging Het
Rev3l T A 10: 39,830,921 Y2223* probably null Het
Slc16a4 A G 3: 107,298,917 Y101C probably benign Het
Slc17a3 A T 13: 23,855,941 I321F possibly damaging Het
Sufu T A 19: 46,449,878 D168E probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tldc1 A T 8: 119,768,290 I243N possibly damaging Het
Vmn1r237 T G 17: 21,314,386 S124A probably benign Het
Vmn2r60 T A 7: 42,194,886 C558S probably damaging Het
Vwa5b1 G A 4: 138,592,103 T414I probably benign Het
Zfp651 T C 9: 121,766,529 S573P probably damaging Het
Zfp971 T G 2: 178,033,881 C424W possibly damaging Het
Other mutations in Ncf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Ncf2 APN 1 152808174 missense possibly damaging 0.49
IGL00952:Ncf2 APN 1 152836106 missense probably benign 0.19
IGL01504:Ncf2 APN 1 152833329 missense probably benign 0.00
IGL01693:Ncf2 APN 1 152824323 missense probably benign 0.00
IGL02005:Ncf2 APN 1 152817052 missense possibly damaging 0.73
IGL02041:Ncf2 APN 1 152836120 utr 3 prime probably benign
IGL02327:Ncf2 APN 1 152816993 missense possibly damaging 0.49
IGL02366:Ncf2 APN 1 152835073 missense probably benign
IGL02627:Ncf2 APN 1 152811008 splice site probably benign
R0560:Ncf2 UTSW 1 152821522 missense probably damaging 1.00
R1136:Ncf2 UTSW 1 152830372 missense probably damaging 1.00
R1640:Ncf2 UTSW 1 152808033 start codon destroyed probably null 1.00
R1673:Ncf2 UTSW 1 152830479 missense probably benign 0.13
R1836:Ncf2 UTSW 1 152808071 missense probably damaging 1.00
R1873:Ncf2 UTSW 1 152825910 missense probably benign 0.00
R1940:Ncf2 UTSW 1 152834064 splice site probably benign
R1967:Ncf2 UTSW 1 152830372 missense probably damaging 1.00
R3405:Ncf2 UTSW 1 152825947 unclassified probably benign
R3406:Ncf2 UTSW 1 152825947 unclassified probably benign
R4501:Ncf2 UTSW 1 152835033 missense probably benign 0.00
R4503:Ncf2 UTSW 1 152833778 missense probably benign 0.20
R4563:Ncf2 UTSW 1 152808225 intron probably benign
R5841:Ncf2 UTSW 1 152821518 splice site silent
R6336:Ncf2 UTSW 1 152834070 missense probably damaging 1.00
R6385:Ncf2 UTSW 1 152830422 missense probably benign 0.00
R6522:Ncf2 UTSW 1 152827463 critical splice donor site probably null
R7048:Ncf2 UTSW 1 152808170 missense probably benign
X0066:Ncf2 UTSW 1 152810979 start codon destroyed probably null 0.27
Z1177:Ncf2 UTSW 1 152825942 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAACAGAACCCCGTTAGATGG -3'
(R):5'- CATATTGCTGTGTGACAGGTTC -3'

Sequencing Primer
(F):5'- AACCCCGTTAGATGGTAAGTC -3'
(R):5'- TGGTAAGTTAGGCCACATTTCC -3'
Posted On2018-09-12