Mutagenetix > Incidental Mutations

Incidental Mutation 'R6811:Vmn2r60'

533803

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r60

Ensembl Gene

ENSMUSG00000090619

Gene Name

vomeronasal 2, receptor 60

Synonyms

Gprc2a-rs3, Casr-rs3, EG637898

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R6811 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

42116471-42195776 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 42194886 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 558 (C558S)

Ref Sequence

ENSEMBL: ENSMUSP00000128493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166447]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166447
AA Change: C558S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128493
Gene: ENSMUSG00000090619
AA Change: C558S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	78	471	1.2e-44	PFAM
Pfam:NCD3G	514	567	5.1e-23	PFAM
Pfam:7tm_3	600	835	1.4e-51	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.1%
20x: 97.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	T	C	15: 74,529,361	S69P	probably damaging	Het
Alkbh7	G	T	17: 56,997,392	R10L	probably benign	Het
Ano3	T	C	2: 110,880,867	E84G	probably benign	Het
Asxl3	A	G	18: 22,522,911	E1326G	possibly damaging	Het
Atrnl1	T	G	19: 57,654,961	M427R	probably damaging	Het
Cenpf	T	C	1: 189,654,542	E1847G	probably benign	Het
Csf1r	T	C	18: 61,119,053	Y536H	probably damaging	Het
Dnm3	T	C	1: 162,321,083	K240E	probably damaging	Het
Dsc1	T	G	18: 20,089,654	E587A	probably benign	Het
Gm16486	T	C	8: 70,716,773	S1171P	probably benign	Het
Gm19410	C	A	8: 35,772,579	A143E	probably damaging	Het
Gm19965	G	T	1: 116,804,079	L38F	probably damaging	Het
Helz	T	C	11: 107,619,318		probably null	Het
Herc2	C	T	7: 56,113,433	R929*	probably null	Het
Krt31	A	G	11: 100,048,416	L225P	probably damaging	Het
Lrp1b	T	C	2: 40,715,500		probably null	Het
Lrp1b	A	G	2: 41,449,194	V765A	probably benign	Het
Lsm5	A	G	6: 56,702,142	I34T	possibly damaging	Het
Ly6g6c	T	C	17: 35,069,410	L86P	probably damaging	Het
Megf11	A	G	9: 64,544,641	T116A	probably damaging	Het
Megf6	T	C	4: 154,252,161	C190R	probably damaging	Het
Mroh9	A	G	1: 163,046,041	V515A	possibly damaging	Het
Mtbp	C	A	15: 55,606,546		probably null	Het
Myo9b	T	A	8: 71,356,578	F1810L	probably damaging	Het
Nacad	T	G	11: 6,599,400	K180Q	possibly damaging	Het
Ncf2	G	A	1: 152,836,040	V502I	probably benign	Het
Npsr1	T	A	9: 24,134,809	C75S	probably benign	Het
Oog3	T	C	4: 144,159,582	T149A	probably benign	Het
Pank1	T	A	19: 34,841,022	Q39L	probably benign	Het
Pdx1	T	C	5: 147,274,664	S232P	possibly damaging	Het
Peg10	T	TCCA	6: 4,756,451		probably benign	Het
Pirb	A	T	7: 3,719,642	V117E	possibly damaging	Het
Ppl	G	A	16: 5,089,144	L1096F	probably damaging	Het
Rev3l	T	A	10: 39,830,921	Y2223*	probably null	Het
Slc16a4	A	G	3: 107,298,917	Y101C	probably benign	Het
Slc17a3	A	T	13: 23,855,941	I321F	possibly damaging	Het
Sufu	T	A	19: 46,449,878	D168E	probably damaging	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Tldc1	A	T	8: 119,768,290	I243N	possibly damaging	Het
Vmn1r237	T	G	17: 21,314,386	S124A	probably benign	Het
Vwa5b1	G	A	4: 138,592,103	T414I	probably benign	Het
Zfp651	T	C	9: 121,766,529	S573P	probably damaging	Het
Zfp971	T	G	2: 178,033,881	C424W	possibly damaging	Het

Other mutations in Vmn2r60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01622:Vmn2r60	APN	7	42136486	missense	probably benign	0.09
IGL01623:Vmn2r60	APN	7	42136486	missense	probably benign	0.09
IGL02363:Vmn2r60	APN	7	42195154	missense	probably benign	0.02
IGL02485:Vmn2r60	APN	7	42195466	missense	possibly damaging	0.54
IGL02651:Vmn2r60	APN	7	42195586	missense	probably damaging	0.99
IGL02660:Vmn2r60	APN	7	42142296	nonsense	probably null
IGL03135:Vmn2r60	APN	7	42136594	missense	probably benign	0.13
IGL03307:Vmn2r60	APN	7	42116547	missense	probably benign	0.14
R0310:Vmn2r60	UTSW	7	42195140	missense	possibly damaging	0.54
R0314:Vmn2r60	UTSW	7	42135561	splice site	probably benign
R0328:Vmn2r60	UTSW	7	42142320	splice site	probably benign
R0464:Vmn2r60	UTSW	7	42135831	missense	probably damaging	0.99
R0755:Vmn2r60	UTSW	7	42195445	missense	probably damaging	1.00
R1119:Vmn2r60	UTSW	7	42194941	missense	possibly damaging	0.68
R1162:Vmn2r60	UTSW	7	42195771	missense	probably benign	0.29
R1241:Vmn2r60	UTSW	7	42137052	missense	probably benign	0.01
R1404:Vmn2r60	UTSW	7	42136787	missense	probably damaging	0.99
R1404:Vmn2r60	UTSW	7	42136787	missense	probably damaging	0.99
R1488:Vmn2r60	UTSW	7	42136713	missense	probably benign	0.17
R1623:Vmn2r60	UTSW	7	42135855	nonsense	probably null
R1628:Vmn2r60	UTSW	7	42136406	nonsense	probably null
R1883:Vmn2r60	UTSW	7	42136670	missense	probably damaging	0.99
R1884:Vmn2r60	UTSW	7	42136670	missense	probably damaging	0.99
R2182:Vmn2r60	UTSW	7	42195507	missense	probably benign	0.06
R2275:Vmn2r60	UTSW	7	42136827	nonsense	probably null
R2847:Vmn2r60	UTSW	7	42136433	missense	probably benign	0.07
R2885:Vmn2r60	UTSW	7	42140979	missense	possibly damaging	0.91
R2894:Vmn2r60	UTSW	7	42135796	missense	probably benign
R2921:Vmn2r60	UTSW	7	42141035	missense	probably damaging	0.98
R2922:Vmn2r60	UTSW	7	42141035	missense	probably damaging	0.98
R3772:Vmn2r60	UTSW	7	42116556	missense	probably benign	0.35
R3820:Vmn2r60	UTSW	7	42135701	missense	probably damaging	0.98
R3822:Vmn2r60	UTSW	7	42135701	missense	probably damaging	0.98
R3872:Vmn2r60	UTSW	7	42136454	missense	probably benign	0.19
R4222:Vmn2r60	UTSW	7	42116528	missense	probably benign	0.08
R4223:Vmn2r60	UTSW	7	42116528	missense	probably benign	0.08
R4224:Vmn2r60	UTSW	7	42116528	missense	probably benign	0.08
R4526:Vmn2r60	UTSW	7	42195243	missense	probably damaging	0.96
R4547:Vmn2r60	UTSW	7	42135663	missense	probably null	0.54
R4840:Vmn2r60	UTSW	7	42135861	missense	probably damaging	1.00
R5173:Vmn2r60	UTSW	7	42195511	missense	probably damaging	0.97
R5231:Vmn2r60	UTSW	7	42137024	missense	possibly damaging	0.93
R5480:Vmn2r60	UTSW	7	42135730	missense	probably damaging	0.98
R5521:Vmn2r60	UTSW	7	42195625	missense	probably damaging	0.99
R5834:Vmn2r60	UTSW	7	42116508	missense	probably benign	0.17
R6038:Vmn2r60	UTSW	7	42194962	missense	probably benign	0.04
R6038:Vmn2r60	UTSW	7	42194962	missense	probably benign	0.04
R6112:Vmn2r60	UTSW	7	42195423	missense	probably damaging	1.00
R6149:Vmn2r60	UTSW	7	42136976	missense	probably damaging	1.00
R6170:Vmn2r60	UTSW	7	42135621	missense	possibly damaging	0.94
R6383:Vmn2r60	UTSW	7	42116471	start codon destroyed	probably null	0.04
R6876:Vmn2r60	UTSW	7	42135663	missense	probably null	0.54
R6997:Vmn2r60	UTSW	7	42142292	missense	probably benign	0.00
R7040:Vmn2r60	UTSW	7	42142242	missense	probably benign	0.00
R7116:Vmn2r60	UTSW	7	42137063	missense	probably benign	0.00
R7128:Vmn2r60	UTSW	7	42195112	missense	probably damaging	0.96
R7232:Vmn2r60	UTSW	7	42136742	missense	possibly damaging	0.83
R7296:Vmn2r60	UTSW	7	42136402	missense	probably benign	0.01
R7376:Vmn2r60	UTSW	7	42195207	missense	probably damaging	1.00
R7526:Vmn2r60	UTSW	7	42195734	frame shift	probably null
R7527:Vmn2r60	UTSW	7	42195734	frame shift	probably null
R7528:Vmn2r60	UTSW	7	42195734	frame shift	probably null
R7529:Vmn2r60	UTSW	7	42195734	frame shift	probably null
R7764:Vmn2r60	UTSW	7	42195111	missense	probably damaging	0.99
RF024:Vmn2r60	UTSW	7	42140939	missense	probably benign	0.01
X0023:Vmn2r60	UTSW	7	42141114	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCCACTATAAGCACTGTATAGACTTG -3'
(R):5'- AGGATGTAGCTGAGAGTCCTG -3'

Sequencing Primer
(F):5'- AGCACTGTATAGACTTGAAATGATTC -3'
(R):5'- CCTGTTATTGGCCTTGACAATG -3'

Posted On

2018-09-12