Incidental Mutation 'R6811:Npsr1'
ID533810
Institutional Source Beutler Lab
Gene Symbol Npsr1
Ensembl Gene ENSMUSG00000043659
Gene Nameneuropeptide S receptor 1
SynonymsVRR1, PGR14, 9330128H10Rik, Gpr154
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6811 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location24097996-24316398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24134809 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 75 (C75S)
Ref Sequence ENSEMBL: ENSMUSP00000117786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059650] [ENSMUST00000133787]
Predicted Effect probably benign
Transcript: ENSMUST00000059650
AA Change: C75S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000056432
Gene: ENSMUSG00000043659
AA Change: C75S

DomainStartEndE-ValueType
Pfam:7tm_1 66 330 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133787
AA Change: C75S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117786
Gene: ENSMUSG00000043659
AA Change: C75S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srbc 18 187 1.3e-7 PFAM
Pfam:7tm_1 66 190 1.8e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vasopressin/oxytocin subfamily of G protein-coupled receptors. The encoded membrane protein acts as a receptor for neuropeptide S and affects a variety of cellular processes through its signaling. Increased expression of this gene in ciliated cells of the respiratory epithelium and in bronchial smooth muscle cells is associated with asthma. Polymorphisms in this gene have also been associated with asthma susceptibility, panic disorders, inflammatory bowel disease, and rheumatoid arthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased airway resistance when treated with high concentrations of U-46619. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,529,361 S69P probably damaging Het
Alkbh7 G T 17: 56,997,392 R10L probably benign Het
Ano3 T C 2: 110,880,867 E84G probably benign Het
Asxl3 A G 18: 22,522,911 E1326G possibly damaging Het
Atrnl1 T G 19: 57,654,961 M427R probably damaging Het
Cenpf T C 1: 189,654,542 E1847G probably benign Het
Csf1r T C 18: 61,119,053 Y536H probably damaging Het
Dnm3 T C 1: 162,321,083 K240E probably damaging Het
Dsc1 T G 18: 20,089,654 E587A probably benign Het
Gm16486 T C 8: 70,716,773 S1171P probably benign Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm19965 G T 1: 116,804,079 L38F probably damaging Het
Helz T C 11: 107,619,318 probably null Het
Herc2 C T 7: 56,113,433 R929* probably null Het
Krt31 A G 11: 100,048,416 L225P probably damaging Het
Lrp1b T C 2: 40,715,500 probably null Het
Lrp1b A G 2: 41,449,194 V765A probably benign Het
Lsm5 A G 6: 56,702,142 I34T possibly damaging Het
Ly6g6c T C 17: 35,069,410 L86P probably damaging Het
Megf11 A G 9: 64,544,641 T116A probably damaging Het
Megf6 T C 4: 154,252,161 C190R probably damaging Het
Mroh9 A G 1: 163,046,041 V515A possibly damaging Het
Mtbp C A 15: 55,606,546 probably null Het
Myo9b T A 8: 71,356,578 F1810L probably damaging Het
Nacad T G 11: 6,599,400 K180Q possibly damaging Het
Ncf2 G A 1: 152,836,040 V502I probably benign Het
Oog3 T C 4: 144,159,582 T149A probably benign Het
Pank1 T A 19: 34,841,022 Q39L probably benign Het
Pdx1 T C 5: 147,274,664 S232P possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pirb A T 7: 3,719,642 V117E possibly damaging Het
Ppl G A 16: 5,089,144 L1096F probably damaging Het
Rev3l T A 10: 39,830,921 Y2223* probably null Het
Slc16a4 A G 3: 107,298,917 Y101C probably benign Het
Slc17a3 A T 13: 23,855,941 I321F possibly damaging Het
Sufu T A 19: 46,449,878 D168E probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tldc1 A T 8: 119,768,290 I243N possibly damaging Het
Vmn1r237 T G 17: 21,314,386 S124A probably benign Het
Vmn2r60 T A 7: 42,194,886 C558S probably damaging Het
Vwa5b1 G A 4: 138,592,103 T414I probably benign Het
Zfp651 T C 9: 121,766,529 S573P probably damaging Het
Zfp971 T G 2: 178,033,881 C424W possibly damaging Het
Other mutations in Npsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Npsr1 APN 9 24254693 missense probably damaging 1.00
IGL02505:Npsr1 APN 9 24098282 missense probably benign
IGL03306:Npsr1 APN 9 24313239 missense probably benign 0.41
IGL03350:Npsr1 APN 9 24098309 missense probably benign
R0057:Npsr1 UTSW 9 24300427 missense probably damaging 1.00
R0385:Npsr1 UTSW 9 24313277 missense probably damaging 0.99
R1432:Npsr1 UTSW 9 24310075 missense probably damaging 1.00
R2033:Npsr1 UTSW 9 24313352 missense probably benign
R2323:Npsr1 UTSW 9 24300436 missense probably damaging 1.00
R2851:Npsr1 UTSW 9 24310005 splice site probably benign
R2852:Npsr1 UTSW 9 24310005 splice site probably benign
R4088:Npsr1 UTSW 9 24313769 missense possibly damaging 0.56
R4757:Npsr1 UTSW 9 24134768 missense probably benign 0.00
R4812:Npsr1 UTSW 9 24289956 missense probably damaging 0.98
R5175:Npsr1 UTSW 9 24134815 missense probably benign 0.11
R5475:Npsr1 UTSW 9 24300419 missense probably damaging 1.00
R5568:Npsr1 UTSW 9 24313214 missense probably damaging 1.00
R5722:Npsr1 UTSW 9 24313800 missense probably damaging 1.00
R6778:Npsr1 UTSW 9 24254618 missense possibly damaging 0.96
R6931:Npsr1 UTSW 9 24289997 missense probably benign 0.27
R7356:Npsr1 UTSW 9 24098261 missense probably benign 0.29
R7569:Npsr1 UTSW 9 24313730 missense probably benign 0.00
R7908:Npsr1 UTSW 9 24289800 missense probably damaging 1.00
R8287:Npsr1 UTSW 9 24289962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCTTCCCTGGGCATTTG -3'
(R):5'- AGCTTGCTAGAGGAAACATCCAAAC -3'

Sequencing Primer
(F):5'- CCATGAAAACACATTCTCGTGC -3'
(R):5'- GGAAACATCCAAACATGGCTTTTATC -3'
Posted On2018-09-12