Incidental Mutation 'R6811:Slc17a3'
ID533817
Institutional Source Beutler Lab
Gene Symbol Slc17a3
Ensembl Gene ENSMUSG00000036083
Gene Namesolute carrier family 17 (sodium phosphate), member 3
SynonymsNpt4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6811 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location23839434-23860716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23855941 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 321 (I321F)
Ref Sequence ENSEMBL: ENSMUSP00000131308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039721] [ENSMUST00000091698] [ENSMUST00000110422] [ENSMUST00000166467]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039721
AA Change: I321F

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039062
Gene: ENSMUSG00000036083
AA Change: I321F

DomainStartEndE-ValueType
Pfam:MFS_1 45 377 3.3e-46 PFAM
transmembrane domain 393 415 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 459 481 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091698
AA Change: I243F

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089290
Gene: ENSMUSG00000036083
AA Change: I243F

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:MFS_1 95 293 2.8e-25 PFAM
transmembrane domain 310 332 N/A INTRINSIC
transmembrane domain 352 369 N/A INTRINSIC
transmembrane domain 379 398 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110422
AA Change: I285F

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106052
Gene: ENSMUSG00000036083
AA Change: I285F

DomainStartEndE-ValueType
Pfam:MFS_1 39 425 6.7e-47 PFAM
transmembrane domain 453 475 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166467
AA Change: I321F

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131308
Gene: ENSMUSG00000036083
AA Change: I321F

DomainStartEndE-ValueType
Pfam:MFS_1 9 338 2.3e-46 PFAM
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a voltage-driven transporter that excretes intracellular urate and organic anions from the blood into renal tubule cells. Two transcript variants encoding different isoforms have been found for this gene. The longer isoform is a plasma membrane protein with transporter activity while the shorter isoform localizes to the endoplasmic reticulum. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,529,361 S69P probably damaging Het
Alkbh7 G T 17: 56,997,392 R10L probably benign Het
Ano3 T C 2: 110,880,867 E84G probably benign Het
Asxl3 A G 18: 22,522,911 E1326G possibly damaging Het
Atrnl1 T G 19: 57,654,961 M427R probably damaging Het
Cenpf T C 1: 189,654,542 E1847G probably benign Het
Csf1r T C 18: 61,119,053 Y536H probably damaging Het
Dnm3 T C 1: 162,321,083 K240E probably damaging Het
Dsc1 T G 18: 20,089,654 E587A probably benign Het
Gm16486 T C 8: 70,716,773 S1171P probably benign Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm19965 G T 1: 116,804,079 L38F probably damaging Het
Helz T C 11: 107,619,318 probably null Het
Herc2 C T 7: 56,113,433 R929* probably null Het
Krt31 A G 11: 100,048,416 L225P probably damaging Het
Lrp1b T C 2: 40,715,500 probably null Het
Lrp1b A G 2: 41,449,194 V765A probably benign Het
Lsm5 A G 6: 56,702,142 I34T possibly damaging Het
Ly6g6c T C 17: 35,069,410 L86P probably damaging Het
Megf11 A G 9: 64,544,641 T116A probably damaging Het
Megf6 T C 4: 154,252,161 C190R probably damaging Het
Mroh9 A G 1: 163,046,041 V515A possibly damaging Het
Mtbp C A 15: 55,606,546 probably null Het
Myo9b T A 8: 71,356,578 F1810L probably damaging Het
Nacad T G 11: 6,599,400 K180Q possibly damaging Het
Ncf2 G A 1: 152,836,040 V502I probably benign Het
Npsr1 T A 9: 24,134,809 C75S probably benign Het
Oog3 T C 4: 144,159,582 T149A probably benign Het
Pank1 T A 19: 34,841,022 Q39L probably benign Het
Pdx1 T C 5: 147,274,664 S232P possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pirb A T 7: 3,719,642 V117E possibly damaging Het
Ppl G A 16: 5,089,144 L1096F probably damaging Het
Rev3l T A 10: 39,830,921 Y2223* probably null Het
Slc16a4 A G 3: 107,298,917 Y101C probably benign Het
Sufu T A 19: 46,449,878 D168E probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tldc1 A T 8: 119,768,290 I243N possibly damaging Het
Vmn1r237 T G 17: 21,314,386 S124A probably benign Het
Vmn2r60 T A 7: 42,194,886 C558S probably damaging Het
Vwa5b1 G A 4: 138,592,103 T414I probably benign Het
Zfp651 T C 9: 121,766,529 S573P probably damaging Het
Zfp971 T G 2: 178,033,881 C424W possibly damaging Het
Other mutations in Slc17a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Slc17a3 APN 13 23856481 missense probably benign 0.20
IGL02569:Slc17a3 APN 13 23846302 missense probably damaging 1.00
IGL02628:Slc17a3 APN 13 23842451 start codon destroyed probably null 1.00
IGL02745:Slc17a3 APN 13 23842486 missense probably benign 0.01
IGL03001:Slc17a3 APN 13 23856784 missense probably damaging 1.00
IGL03143:Slc17a3 APN 13 23855979 splice site probably null
IGL03144:Slc17a3 APN 13 23846440 missense probably benign 0.00
R0052:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0054:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0131:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0131:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0152:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0153:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0233:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0234:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0257:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0294:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0295:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0318:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0319:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0352:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0462:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0610:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0627:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0652:Slc17a3 UTSW 13 23855858 missense probably damaging 1.00
R0765:Slc17a3 UTSW 13 23846896 nonsense probably null
R1529:Slc17a3 UTSW 13 23845445 missense probably damaging 1.00
R1532:Slc17a3 UTSW 13 23856500 missense probably damaging 1.00
R1569:Slc17a3 UTSW 13 23855608 missense probably benign 0.09
R1640:Slc17a3 UTSW 13 23852357 nonsense probably null
R1643:Slc17a3 UTSW 13 23857198 splice site probably benign
R1715:Slc17a3 UTSW 13 23856741 missense probably benign 0.19
R2407:Slc17a3 UTSW 13 23852435 critical splice donor site probably null
R2512:Slc17a3 UTSW 13 23846247 missense probably benign 0.13
R3923:Slc17a3 UTSW 13 23858054 missense possibly damaging 0.89
R4449:Slc17a3 UTSW 13 23856732 missense probably damaging 0.99
R5166:Slc17a3 UTSW 13 23842542 critical splice donor site probably null
R5748:Slc17a3 UTSW 13 23856466 missense probably damaging 1.00
R5989:Slc17a3 UTSW 13 23842428 start gained probably benign
R6281:Slc17a3 UTSW 13 23856799 missense probably benign 0.17
R7283:Slc17a3 UTSW 13 23855848 missense
R7341:Slc17a3 UTSW 13 23846884 nonsense probably null
R7467:Slc17a3 UTSW 13 23846967 critical splice donor site probably null
R7485:Slc17a3 UTSW 13 23855849 missense
R8065:Slc17a3 UTSW 13 23858087 missense unknown
Predicted Primers PCR Primer
(F):5'- AATGGTGGCTGAGACTCTGAG -3'
(R):5'- GCAACCTCCCAGCAAAGTTG -3'

Sequencing Primer
(F):5'- AGACTCTGAGCCTCGTGTTGATC -3'
(R):5'- TTTTAAATATCAAGCACGGGGG -3'
Posted On2018-09-12