Incidental Mutation 'R6811:Atrnl1'
ID533829
Institutional Source Beutler Lab
Gene Symbol Atrnl1
Ensembl Gene ENSMUSG00000054843
Gene Nameattractin like 1
SynonymsAlp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R6811 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location57611034-58133338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57654961 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 427 (M427R)
Ref Sequence ENSEMBL: ENSMUSP00000076514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077282]
Predicted Effect probably damaging
Transcript: ENSMUST00000077282
AA Change: M427R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: M427R

DomainStartEndE-ValueType
low complexity region 25 32 N/A INTRINSIC
EGF 61 90 5.71e-1 SMART
CUB 92 208 1.43e-11 SMART
EGF 209 244 1.95e1 SMART
Pfam:EGF_2 248 279 5.8e-7 PFAM
Pfam:Kelch_5 350 391 2.1e-9 PFAM
Pfam:Kelch_6 354 401 5.8e-8 PFAM
Pfam:Kelch_4 465 517 4.3e-7 PFAM
Pfam:Kelch_1 519 573 2.7e-6 PFAM
PSI 613 656 3.38e-1 SMART
PSI 665 708 2e-3 SMART
PSI 714 759 1.72e-2 SMART
CLECT 747 872 2.86e-20 SMART
PSI 888 938 6.26e-5 SMART
PSI 941 1011 1.73e-7 SMART
EGF_Lam 1013 1056 1.07e-5 SMART
low complexity region 1157 1173 N/A INTRINSIC
transmembrane domain 1229 1251 N/A INTRINSIC
low complexity region 1261 1272 N/A INTRINSIC
low complexity region 1326 1339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.1%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,529,361 S69P probably damaging Het
Alkbh7 G T 17: 56,997,392 R10L probably benign Het
Ano3 T C 2: 110,880,867 E84G probably benign Het
Asxl3 A G 18: 22,522,911 E1326G possibly damaging Het
Cenpf T C 1: 189,654,542 E1847G probably benign Het
Csf1r T C 18: 61,119,053 Y536H probably damaging Het
Dnm3 T C 1: 162,321,083 K240E probably damaging Het
Dsc1 T G 18: 20,089,654 E587A probably benign Het
Gm16486 T C 8: 70,716,773 S1171P probably benign Het
Gm19410 C A 8: 35,772,579 A143E probably damaging Het
Gm19965 G T 1: 116,804,079 L38F probably damaging Het
Helz T C 11: 107,619,318 probably null Het
Herc2 C T 7: 56,113,433 R929* probably null Het
Krt31 A G 11: 100,048,416 L225P probably damaging Het
Lrp1b T C 2: 40,715,500 probably null Het
Lrp1b A G 2: 41,449,194 V765A probably benign Het
Lsm5 A G 6: 56,702,142 I34T possibly damaging Het
Ly6g6c T C 17: 35,069,410 L86P probably damaging Het
Megf11 A G 9: 64,544,641 T116A probably damaging Het
Megf6 T C 4: 154,252,161 C190R probably damaging Het
Mroh9 A G 1: 163,046,041 V515A possibly damaging Het
Mtbp C A 15: 55,606,546 probably null Het
Myo9b T A 8: 71,356,578 F1810L probably damaging Het
Nacad T G 11: 6,599,400 K180Q possibly damaging Het
Ncf2 G A 1: 152,836,040 V502I probably benign Het
Npsr1 T A 9: 24,134,809 C75S probably benign Het
Oog3 T C 4: 144,159,582 T149A probably benign Het
Pank1 T A 19: 34,841,022 Q39L probably benign Het
Pdx1 T C 5: 147,274,664 S232P possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pirb A T 7: 3,719,642 V117E possibly damaging Het
Ppl G A 16: 5,089,144 L1096F probably damaging Het
Rev3l T A 10: 39,830,921 Y2223* probably null Het
Slc16a4 A G 3: 107,298,917 Y101C probably benign Het
Slc17a3 A T 13: 23,855,941 I321F possibly damaging Het
Sufu T A 19: 46,449,878 D168E probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tldc1 A T 8: 119,768,290 I243N possibly damaging Het
Vmn1r237 T G 17: 21,314,386 S124A probably benign Het
Vmn2r60 T A 7: 42,194,886 C558S probably damaging Het
Vwa5b1 G A 4: 138,592,103 T414I probably benign Het
Zfp651 T C 9: 121,766,529 S573P probably damaging Het
Zfp971 T G 2: 178,033,881 C424W possibly damaging Het
Other mutations in Atrnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Atrnl1 APN 19 57691817 missense probably benign 0.02
IGL00707:Atrnl1 APN 19 57673265 missense probably damaging 0.96
IGL00921:Atrnl1 APN 19 57702153 missense probably damaging 1.00
IGL01410:Atrnl1 APN 19 58131104 missense probably damaging 1.00
IGL01468:Atrnl1 APN 19 57699712 missense probably benign 0.02
IGL01756:Atrnl1 APN 19 57652948 missense probably benign
IGL01971:Atrnl1 APN 19 57753283 missense probably damaging 1.00
IGL02019:Atrnl1 APN 19 57691763 splice site probably benign
IGL02580:Atrnl1 APN 19 57714576 splice site probably benign
IGL02649:Atrnl1 APN 19 57650441 splice site probably benign
IGL02676:Atrnl1 APN 19 57691884 missense probably damaging 1.00
IGL03276:Atrnl1 APN 19 57652927 missense probably damaging 0.99
IGL03379:Atrnl1 APN 19 57642541 missense probably benign 0.02
Magnetogorsk UTSW 19 57630306 missense probably damaging 1.00
polar UTSW 19 57652950 missense probably benign 0.00
PIT4812001:Atrnl1 UTSW 19 57731623 missense probably benign 0.08
R0109:Atrnl1 UTSW 19 57755517 missense possibly damaging 0.78
R0308:Atrnl1 UTSW 19 57753288 missense probably benign 0.04
R0394:Atrnl1 UTSW 19 57673176 missense probably benign 0.10
R0734:Atrnl1 UTSW 19 57654861 missense probably damaging 1.00
R0811:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R0812:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R1183:Atrnl1 UTSW 19 57650293 missense probably damaging 0.97
R1213:Atrnl1 UTSW 19 57638462 missense probably benign 0.25
R1344:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1418:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1707:Atrnl1 UTSW 19 57686737 missense probably benign 0.00
R1748:Atrnl1 UTSW 19 57714702 missense probably damaging 0.99
R2051:Atrnl1 UTSW 19 57691849 missense probably benign 0.01
R2113:Atrnl1 UTSW 19 57755616 nonsense probably null
R2130:Atrnl1 UTSW 19 57654994 missense probably damaging 1.00
R3710:Atrnl1 UTSW 19 57657114 missense probably damaging 1.00
R3916:Atrnl1 UTSW 19 57935652 missense possibly damaging 0.82
R4524:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R4707:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4712:Atrnl1 UTSW 19 57652950 missense probably benign 0.00
R4784:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4785:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4798:Atrnl1 UTSW 19 58042361 missense probably benign
R5172:Atrnl1 UTSW 19 57685513 nonsense probably null
R5226:Atrnl1 UTSW 19 57650335 missense probably benign
R5289:Atrnl1 UTSW 19 57657082 missense probably damaging 1.00
R5372:Atrnl1 UTSW 19 57755536 missense probably benign
R5737:Atrnl1 UTSW 19 57777888 missense possibly damaging 0.84
R5782:Atrnl1 UTSW 19 57753286 missense possibly damaging 0.95
R5826:Atrnl1 UTSW 19 57630292 nonsense probably null
R6169:Atrnl1 UTSW 19 57642463 missense probably benign 0.00
R6242:Atrnl1 UTSW 19 57642478 missense probably benign 0.02
R6342:Atrnl1 UTSW 19 57638510 missense probably damaging 1.00
R6372:Atrnl1 UTSW 19 57650332 missense probably benign 0.01
R6897:Atrnl1 UTSW 19 58042368 missense probably benign 0.01
R7024:Atrnl1 UTSW 19 57638450 critical splice acceptor site probably null
R7085:Atrnl1 UTSW 19 57691857 missense probably damaging 1.00
R7144:Atrnl1 UTSW 19 58042352 missense probably damaging 1.00
R7259:Atrnl1 UTSW 19 57935606 nonsense probably null
R7289:Atrnl1 UTSW 19 57650414 missense probably benign 0.13
R7310:Atrnl1 UTSW 19 57642424 missense possibly damaging 0.69
R7372:Atrnl1 UTSW 19 57935646 missense possibly damaging 0.47
R7432:Atrnl1 UTSW 19 57755524 missense probably damaging 1.00
R7478:Atrnl1 UTSW 19 57696312 missense possibly damaging 0.89
R7556:Atrnl1 UTSW 19 57654846 missense probably benign
R7567:Atrnl1 UTSW 19 57699523 missense probably damaging 0.98
R7608:Atrnl1 UTSW 19 57714687 missense probably damaging 1.00
R7632:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R7655:Atrnl1 UTSW 19 57611379 nonsense probably null
R7656:Atrnl1 UTSW 19 57611379 nonsense probably null
R7718:Atrnl1 UTSW 19 57740183 nonsense probably null
R7721:Atrnl1 UTSW 19 57696331 missense probably benign 0.00
R7726:Atrnl1 UTSW 19 57702072 missense probably damaging 1.00
R7733:Atrnl1 UTSW 19 57701988 missense probably benign 0.00
R7774:Atrnl1 UTSW 19 57699671 missense probably damaging 1.00
R8010:Atrnl1 UTSW 19 57682446 missense probably benign 0.14
R8119:Atrnl1 UTSW 19 57642463 missense probably benign 0.00
RF021:Atrnl1 UTSW 19 57642473 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTATGTACGGAGGCAGAATGG -3'
(R):5'- TGGCTGAGAGATGATACCCAAG -3'

Sequencing Primer
(F):5'- TGGAGACCAGTGATGGCAAC -3'
(R):5'- GCTGAGAGATGATACCCAAGTATTC -3'
Posted On2018-09-12