Incidental Mutation 'R6812:Scnn1a'
ID533840
Institutional Source Beutler Lab
Gene Symbol Scnn1a
Ensembl Gene ENSMUSG00000030340
Gene Namesodium channel, nonvoltage-gated 1 alpha
SynonymsENaC alpha, mENaC, Scnn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6812 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location125320659-125344943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125337856 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 314 (N314S)
Ref Sequence ENSEMBL: ENSMUSP00000134929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081440] [ENSMUST00000175966] [ENSMUST00000176110] [ENSMUST00000176442] [ENSMUST00000176655] [ENSMUST00000177329]
Predicted Effect probably benign
Transcript: ENSMUST00000081440
AA Change: N340S

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080164
Gene: ENSMUSG00000030340
AA Change: N340S

DomainStartEndE-ValueType
low complexity region 13 18 N/A INTRINSIC
Pfam:ASC 88 600 1.1e-93 PFAM
low complexity region 647 677 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000175966
SMART Domains Protein: ENSMUSP00000135551
Gene: ENSMUSG00000030340

DomainStartEndE-ValueType
Pfam:ASC 62 264 3.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176110
AA Change: N314S

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134940
Gene: ENSMUSG00000030340
AA Change: N314S

DomainStartEndE-ValueType
Pfam:ASC 62 575 1.9e-112 PFAM
low complexity region 621 651 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176442
AA Change: N233S

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135336
Gene: ENSMUSG00000030340
AA Change: N233S

DomainStartEndE-ValueType
Pfam:ASC 1 494 6.3e-105 PFAM
low complexity region 540 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176655
AA Change: N233S

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135798
Gene: ENSMUSG00000030340
AA Change: N233S

DomainStartEndE-ValueType
Pfam:ASC 1 494 6.4e-105 PFAM
low complexity region 540 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177329
AA Change: N314S

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134929
Gene: ENSMUSG00000030340
AA Change: N314S

DomainStartEndE-ValueType
Pfam:ASC 62 575 1.9e-112 PFAM
low complexity region 621 651 N/A INTRINSIC
Meta Mutation Damage Score 0.012 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the alpha subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), a rare salt wasting disease resulting from target organ unresponsiveness to mineralocorticoids. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skin with epithelial hyperplasia, abnormal nuclei, premature lipid secretion, and abnormal keratohyaline granules. Mutants die within 40 hours of birth due to inability to clear their lungs of liquid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Scnn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Scnn1a APN 6 125338379 missense probably benign 0.11
IGL01793:Scnn1a APN 6 125343703 missense probably benign 0.03
IGL01992:Scnn1a APN 6 125338937 critical splice donor site probably null
IGL03280:Scnn1a APN 6 125342781 splice site probably benign
R0086:Scnn1a UTSW 6 125342587 splice site probably benign
R0442:Scnn1a UTSW 6 125339137 missense probably damaging 1.00
R0454:Scnn1a UTSW 6 125322226 missense probably damaging 1.00
R0578:Scnn1a UTSW 6 125322244 missense probably damaging 0.97
R1538:Scnn1a UTSW 6 125338893 missense possibly damaging 0.48
R1579:Scnn1a UTSW 6 125322140 missense probably damaging 1.00
R1803:Scnn1a UTSW 6 125332194 missense probably damaging 0.98
R1876:Scnn1a UTSW 6 125338838 missense probably benign 0.05
R2113:Scnn1a UTSW 6 125337811 missense possibly damaging 0.60
R2178:Scnn1a UTSW 6 125331002 missense probably damaging 0.96
R2960:Scnn1a UTSW 6 125322293 missense probably damaging 1.00
R4072:Scnn1a UTSW 6 125338907 missense probably damaging 1.00
R4603:Scnn1a UTSW 6 125322160 missense probably damaging 1.00
R4928:Scnn1a UTSW 6 125322173 missense probably damaging 1.00
R5436:Scnn1a UTSW 6 125343022 missense possibly damaging 0.94
R7089:Scnn1a UTSW 6 125337807 missense probably benign 0.05
X0026:Scnn1a UTSW 6 125322110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCTACTTCCCAGTGCTG -3'
(R):5'- GACCTTTCCAGAATGGCGAGAG -3'

Sequencing Primer
(F):5'- TACTTCCCAGTGCTGTGCAGG -3'
(R):5'- GGCATATCAAGGTGAGACCC -3'
Posted On2018-09-12