Incidental Mutation 'R6812:Fsd2'
ID533847
Institutional Source Beutler Lab
Gene Symbol Fsd2
Ensembl Gene ENSMUSG00000038663
Gene Namefibronectin type III and SPRY domain containing 2
SynonymsSpryd1, 9830160G03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6812 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location81533308-81566944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 81535089 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 686 (H686Q)
Ref Sequence ENSEMBL: ENSMUSP00000047775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042318]
Predicted Effect probably benign
Transcript: ENSMUST00000042318
AA Change: H686Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000047775
Gene: ENSMUSG00000038663
AA Change: H686Q

DomainStartEndE-ValueType
low complexity region 102 121 N/A INTRINSIC
coiled coil region 204 231 N/A INTRINSIC
FN3 315 400 7.34e-9 SMART
FN3 412 494 2e-1 SMART
Pfam:PRY 509 558 8.6e-9 PFAM
Pfam:SPRY 564 683 2.8e-12 PFAM
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the FN3/SPRY family of proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Fsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Fsd2 APN 7 81553007 missense probably benign 0.15
IGL02012:Fsd2 APN 7 81549914 missense probably benign 0.00
IGL02061:Fsd2 APN 7 81540424 nonsense probably null
IGL02971:Fsd2 APN 7 81548923 nonsense probably null
IGL03207:Fsd2 APN 7 81559170 missense probably benign 0.28
IGL03344:Fsd2 APN 7 81559909 missense probably benign 0.00
R0142:Fsd2 UTSW 7 81559935 missense probably damaging 0.98
R0540:Fsd2 UTSW 7 81545017 missense probably damaging 1.00
R0607:Fsd2 UTSW 7 81545017 missense probably damaging 1.00
R0846:Fsd2 UTSW 7 81540397 missense probably benign 0.00
R0863:Fsd2 UTSW 7 81542165 missense possibly damaging 0.47
R1172:Fsd2 UTSW 7 81559770 missense probably benign
R1173:Fsd2 UTSW 7 81559770 missense probably benign
R1175:Fsd2 UTSW 7 81559770 missense probably benign
R1438:Fsd2 UTSW 7 81548873 missense probably benign 0.13
R1456:Fsd2 UTSW 7 81559591 nonsense probably null
R1717:Fsd2 UTSW 7 81535109 missense probably benign 0.23
R1987:Fsd2 UTSW 7 81559659 missense possibly damaging 0.89
R2698:Fsd2 UTSW 7 81545860 missense probably damaging 0.99
R4108:Fsd2 UTSW 7 81544967 missense probably benign 0.01
R4165:Fsd2 UTSW 7 81545860 missense probably damaging 0.99
R4335:Fsd2 UTSW 7 81542065 missense probably damaging 0.99
R4570:Fsd2 UTSW 7 81559770 missense probably benign
R4707:Fsd2 UTSW 7 81559680 missense probably damaging 1.00
R4741:Fsd2 UTSW 7 81551895 critical splice donor site probably null
R4863:Fsd2 UTSW 7 81552964 missense probably null 0.91
R5281:Fsd2 UTSW 7 81552985 missense probably benign 0.15
R5898:Fsd2 UTSW 7 81537227 missense probably damaging 1.00
R7367:Fsd2 UTSW 7 81535180 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCAAGTTCAGCCAGGGAG -3'
(R):5'- ACTGACAGTATAAAGCACTCTGC -3'

Sequencing Primer
(F):5'- TTCAGCCAGGGAGGGGAG -3'
(R):5'- ACTCTGCAAGCAGCTCG -3'
Posted On2018-09-12