Incidental Mutation 'R6812:Rev3l'
ID533855
Institutional Source Beutler Lab
Gene Symbol Rev3l
Ensembl Gene ENSMUSG00000019841
Gene NameREV3 like, DNA directed polymerase zeta catalytic subunit
SynonymsSez4, Rev
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6812 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location39732118-39875211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 39823548 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1347 (R1347L)
Ref Sequence ENSEMBL: ENSMUSP00000131519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]
Predicted Effect probably benign
Transcript: ENSMUST00000019986
AA Change: R1347L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: R1347L

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 201 1.6e-10 PFAM
low complexity region 494 506 N/A INTRINSIC
low complexity region 959 969 N/A INTRINSIC
low complexity region 1042 1057 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3103 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131186
Predicted Effect probably benign
Transcript: ENSMUST00000139803
SMART Domains Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

DomainStartEndE-ValueType
Blast:POLBc 1 369 1e-155 BLAST
POLBc 434 805 4.77e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164763
AA Change: R1347L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: R1347L

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 200 1.3e-11 PFAM
low complexity region 494 506 N/A INTRINSIC
Pfam:DUF4683 745 1132 1.7e-162 PFAM
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3102 6.1e-15 PFAM
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Rev3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Rev3l APN 10 39806969 missense probably benign
IGL00815:Rev3l APN 10 39859153 missense possibly damaging 0.79
IGL00964:Rev3l APN 10 39864806 missense probably benign 0.39
IGL01765:Rev3l APN 10 39828265 missense probably benign 0.00
IGL01792:Rev3l APN 10 39823340 missense probably benign
IGL01950:Rev3l APN 10 39821157 missense probably damaging 1.00
IGL01963:Rev3l APN 10 39822737 missense possibly damaging 0.90
IGL02089:Rev3l APN 10 39825099 missense probably damaging 1.00
IGL02288:Rev3l APN 10 39828216 missense probably benign
IGL02381:Rev3l APN 10 39821346 missense possibly damaging 0.83
IGL02409:Rev3l APN 10 39821148 missense possibly damaging 0.75
IGL02434:Rev3l APN 10 39822591 missense probably damaging 1.00
IGL02570:Rev3l APN 10 39848013 missense possibly damaging 0.68
IGL02581:Rev3l APN 10 39821281 missense probably benign 0.10
IGL02654:Rev3l APN 10 39862734 missense probably damaging 1.00
IGL02720:Rev3l APN 10 39822395 nonsense probably null
IGL02746:Rev3l APN 10 39824589 missense probably damaging 0.99
IGL02829:Rev3l APN 10 39825240 missense probably damaging 1.00
IGL02961:Rev3l APN 10 39827945 missense possibly damaging 0.65
IGL02974:Rev3l APN 10 39862747 nonsense probably null
IGL03029:Rev3l APN 10 39828486 missense probably benign 0.34
IGL03153:Rev3l APN 10 39806878 missense probably damaging 1.00
IGL03172:Rev3l APN 10 39824790 missense probably benign 0.10
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0153:Rev3l UTSW 10 39874128 nonsense probably null
R0308:Rev3l UTSW 10 39824894 missense probably benign 0.09
R0355:Rev3l UTSW 10 39817286 missense probably damaging 1.00
R0513:Rev3l UTSW 10 39828143 missense probably benign 0.00
R0523:Rev3l UTSW 10 39848049 missense probably benign 0.02
R0559:Rev3l UTSW 10 39824487 missense probably damaging 1.00
R0761:Rev3l UTSW 10 39874195 missense probably benign 0.32
R1023:Rev3l UTSW 10 39832639 missense probably damaging 1.00
R1159:Rev3l UTSW 10 39851925 nonsense probably null
R1398:Rev3l UTSW 10 39821583 missense probably benign 0.05
R1478:Rev3l UTSW 10 39783333 critical splice donor site probably null
R1517:Rev3l UTSW 10 39838443 missense probably benign 0.34
R1527:Rev3l UTSW 10 39822822 missense probably damaging 1.00
R1635:Rev3l UTSW 10 39806662 missense probably damaging 0.98
R1695:Rev3l UTSW 10 39824615 nonsense probably null
R1695:Rev3l UTSW 10 39824616 missense probably damaging 0.97
R1782:Rev3l UTSW 10 39799885 missense probably benign
R1815:Rev3l UTSW 10 39822871 missense probably benign 0.41
R1818:Rev3l UTSW 10 39828424 missense probably benign 0.05
R2039:Rev3l UTSW 10 39824444 missense probably damaging 1.00
R2071:Rev3l UTSW 10 39824353 missense probably benign 0.17
R2101:Rev3l UTSW 10 39828096 missense probably benign 0.00
R2141:Rev3l UTSW 10 39848049 missense probably benign 0.02
R2883:Rev3l UTSW 10 39825156 missense probably damaging 1.00
R3787:Rev3l UTSW 10 39846210 missense probably damaging 0.97
R3910:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3912:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3913:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R4590:Rev3l UTSW 10 39806933 missense probably damaging 1.00
R4631:Rev3l UTSW 10 39828416 missense probably benign 0.44
R4633:Rev3l UTSW 10 39846186 missense probably damaging 1.00
R4707:Rev3l UTSW 10 39823397 missense probably damaging 0.99
R4724:Rev3l UTSW 10 39846806 nonsense probably null
R4810:Rev3l UTSW 10 39823725 missense probably benign 0.01
R4857:Rev3l UTSW 10 39838459 missense probably damaging 1.00
R4882:Rev3l UTSW 10 39821460 missense possibly damaging 0.89
R4928:Rev3l UTSW 10 39823985 missense probably benign 0.30
R4970:Rev3l UTSW 10 39823330 missense probably benign 0.00
R4977:Rev3l UTSW 10 39823578 missense possibly damaging 0.80
R5112:Rev3l UTSW 10 39823330 missense probably benign 0.00
R5261:Rev3l UTSW 10 39846729 missense probably damaging 1.00
R5419:Rev3l UTSW 10 39824931 missense possibly damaging 0.95
R5570:Rev3l UTSW 10 39852075 critical splice donor site probably null
R5628:Rev3l UTSW 10 39822967 missense probably damaging 0.98
R5689:Rev3l UTSW 10 39794958 missense probably damaging 1.00
R5781:Rev3l UTSW 10 39823093 missense probably benign 0.00
R5829:Rev3l UTSW 10 39806906 missense probably damaging 0.97
R5984:Rev3l UTSW 10 39742689 intron probably benign
R5990:Rev3l UTSW 10 39823811 missense probably benign 0.17
R6054:Rev3l UTSW 10 39824150 missense probably benign 0.01
R6171:Rev3l UTSW 10 39862713 nonsense probably null
R6220:Rev3l UTSW 10 39822779 missense probably damaging 1.00
R6520:Rev3l UTSW 10 39822702 missense probably benign 0.06
R6798:Rev3l UTSW 10 39854763 missense probably damaging 1.00
R6811:Rev3l UTSW 10 39830921 nonsense probably null
R6904:Rev3l UTSW 10 39821481 missense probably benign
R6905:Rev3l UTSW 10 39817327 missense probably benign 0.18
R6938:Rev3l UTSW 10 39862710 missense probably damaging 1.00
R7037:Rev3l UTSW 10 39851975 missense probably damaging 1.00
R7124:Rev3l UTSW 10 39822167 nonsense probably null
R7286:Rev3l UTSW 10 39823605 missense probably damaging 0.99
R7385:Rev3l UTSW 10 39823682 missense probably benign 0.01
X0022:Rev3l UTSW 10 39828607 critical splice donor site probably null
Z1088:Rev3l UTSW 10 39824318 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GGAATTAGTGCACAACAGCG -3'
(R):5'- ATTAGGGGCACAGACTTGTTC -3'

Sequencing Primer
(F):5'- AACAGCGGCTGTCTAACTG -3'
(R):5'- GATTCTAGGGAACTGCGATACTC -3'
Posted On2018-09-12