Mutagenetix > Incidental Mutations

Incidental Mutation 'R6812:Arid4a'

533865

Institutional Source

Beutler Lab

Gene Symbol

Arid4a

Ensembl Gene

ENSMUSG00000048118

Gene Name

AT rich interactive domain 4A (RBP1-like)

Synonyms

Rbbp1, A630067N03Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6812 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71015990-71098592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 71047263 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 270 (E270G)

Ref Sequence

ENSEMBL: ENSMUSP00000035512 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046305] [ENSMUST00000125125] [ENSMUST00000135709]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046305
AA Change: E270G

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000035512
Gene: ENSMUSG00000048118
AA Change: E270G

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
TUDOR	58	114	3.6e-12	SMART
low complexity region	152	167	N/A	INTRINSIC
Pfam:RBB1NT	170	262	4e-32	PFAM
ARID	306	397	6.7e-37	SMART
BRIGHT	310	402	2.3e-40	SMART
low complexity region	411	422	N/A	INTRINSIC
CHROMO	483	652	6.8e-6	SMART
low complexity region	690	707	N/A	INTRINSIC
low complexity region	965	976	N/A	INTRINSIC
low complexity region	991	1003	N/A	INTRINSIC
coiled coil region	1185	1224	N/A	INTRINSIC
low complexity region	1229	1252	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000125125
AA Change: E270G

SMART Domains

Protein: ENSMUSP00000121109
Gene: ENSMUSG00000048118
AA Change: E270G

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
TUDOR	58	114	5.53e-10	SMART
low complexity region	152	167	N/A	INTRINSIC
Pfam:RBB1NT	168	263	6e-49	PFAM
low complexity region	267	295	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135709

SMART Domains

Protein: ENSMUSP00000121319
Gene: ENSMUSG00000048118

Domain	Start	End	E-Value	Type
ARID	1	75	1.02e-16	SMART
BRIGHT	1	80	2.05e-23	SMART
low complexity region	89	100	N/A	INTRINSIC
CHROMO	161	330	1.08e-3	SMART
low complexity region	368	385	N/A	INTRINSIC

Meta Mutation Damage Score

0.4750

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.0%
20x: 97.4%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein (pRB) which regulates cell proliferation. pRB represses transcription by recruiting the encoded protein. This protein, in turn, serves as a bridging molecule to recruit HDACs and, in addition, provides a second HDAC-independent repression function. The encoded protein possesses transcriptional repression activity. Multiple alternatively spliced transcripts have been observed for this gene, although not all transcript variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered DNA methylation patterns, disrupted hematopoiesis and a portion develop acute myeloid leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg7	C	T	16: 56,795,798		probably benign	Het
Ak9	A	T	10: 41,367,167	M686L	unknown	Het
Ap3b1	A	T	13: 94,479,861	T757S	unknown	Het
Apob	A	T	12: 7,983,062	K139N	probably damaging	Het
Atp1a2	A	T	1: 172,284,877	C515S	probably benign	Het
Bicd1	T	C	6: 149,409,537	Y37H	probably damaging	Het
Birc3	T	G	9: 7,854,417	D424A	probably damaging	Het
Ccdc97	A	T	7: 25,713,044	F324L	probably damaging	Het
Crim1	T	A	17: 78,315,600	I409N	probably damaging	Het
Cul7	T	A	17: 46,661,409	I1233N	probably benign	Het
Dcaf1	T	C	9: 106,858,069	S739P	probably damaging	Het
Ddb1	T	C	19: 10,622,499		probably null	Het
Dennd5b	T	C	6: 149,081,132		probably benign	Het
Dna2	A	G	10: 62,959,341	S464G	probably benign	Het
Dnah9	C	T	11: 65,981,329	V2692M	probably damaging	Het
Dvl2	T	C	11: 70,000,995	Y55H	probably damaging	Het
Eif4g3	G	T	4: 138,103,376	Q140H	probably damaging	Het
Enpp5	G	A	17: 44,085,576	V460M	probably benign	Het
Etv2	G	T	7: 30,634,001	C265*	probably null	Het
F12	T	C	13: 55,421,845	E146G	probably damaging	Het
Fdps	C	A	3: 89,094,476	E301D	possibly damaging	Het
Fsd2	G	T	7: 81,535,089	H686Q	probably benign	Het
Gk5	T	C	9: 96,150,749	S262P	probably damaging	Het
Gm20730	A	G	6: 43,081,788	V30A	probably benign	Het
Gpr68	C	A	12: 100,878,411	E291D	probably damaging	Het
Gucy2c	A	G	6: 136,697,995	V1006A	probably benign	Het
Itgb1	T	A	8: 128,705,410		probably null	Het
Kif2a	A	T	13: 106,969,751	D570E	probably benign	Het
Krt8	G	T	15: 101,997,979	A365D	probably damaging	Het
Lias	T	A	5: 65,408,789	V373E	possibly damaging	Het
Mpl	A	G	4: 118,455,264	V169A	probably benign	Het
Myh3	T	A	11: 67,086,402	I319N	probably damaging	Het
Myrfl	T	A	10: 116,832,913	K315I	probably damaging	Het
Nrap	T	C	19: 56,351,676	D803G	probably damaging	Het
Olfr1475	T	C	19: 13,479,611	T196A	probably benign	Het
Pald1	A	G	10: 61,342,922	S536P	possibly damaging	Het
Phka2	G	A	X: 160,533,048	V230I	probably damaging	Het
Prkaa2	T	A	4: 105,047,152	T243S	probably benign	Het
Prrc2b	T	A	2: 32,213,141	V877D	probably benign	Het
Rbm27	T	A	18: 42,333,403		probably null	Het
Rbm48	A	G	5: 3,596,105	V33A	probably benign	Het
Rev3l	G	T	10: 39,823,548	R1347L	probably benign	Het
Rnf219	A	G	14: 104,510,432	V40A	unknown	Het
Rtp3	A	G	9: 110,987,112	F124L	probably benign	Het
Ryr3	C	T	2: 112,946,906	G302D	probably damaging	Het
Scnn1a	A	G	6: 125,337,856	N314S	probably benign	Het
Sik3	C	T	9: 46,210,769	R907W	probably damaging	Het
Sox5	C	T	6: 144,116,443		probably null	Het
Tmc1	A	C	19: 20,900,861	L90R	probably damaging	Het
Tmtc2	A	G	10: 105,413,269	V201A	probably benign	Het
Uvrag	T	A	7: 98,888,482	H502L	probably benign	Het
Vwa8	T	A	14: 79,197,419	I1760N	probably damaging	Het
Zfp318	G	GAAGAAT	17: 46,412,542		probably benign	Het
Zfp772	T	C	7: 7,206,308	D61G	possibly damaging	Het

Other mutations in Arid4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Arid4a	APN	12	71072593	missense	probably damaging	1.00
IGL00546:Arid4a	APN	12	71075671	missense	probably benign
IGL00553:Arid4a	APN	12	71075977	missense	probably benign	0.04
IGL00708:Arid4a	APN	12	71072728	missense	probably benign	0.02
IGL00847:Arid4a	APN	12	71075718	missense	probably damaging	1.00
IGL01112:Arid4a	APN	12	71072733	critical splice donor site	probably null
IGL01456:Arid4a	APN	12	71067262	missense	probably benign	0.00
IGL01505:Arid4a	APN	12	71037115	missense	probably damaging	1.00
IGL01555:Arid4a	APN	12	71061527	splice site	probably benign
IGL01631:Arid4a	APN	12	71022262	splice site	probably benign
IGL02958:Arid4a	APN	12	71097563	missense	probably benign	0.01
IGL03087:Arid4a	APN	12	71075245	missense	possibly damaging	0.94
IGL03111:Arid4a	APN	12	71039966	missense	probably damaging	1.00
IGL03234:Arid4a	APN	12	71045060	missense	probably benign	0.34
After_8	UTSW	12	71023498	critical splice acceptor site	probably null
ariano	UTSW	12	71069860	nonsense	probably null
guava	UTSW	12	71072632	missense	probably damaging	0.99
limoncello	UTSW	12	71067341	splice site	probably null
Sahara	UTSW	12	71060115	nonsense	probably null
Under_8	UTSW	12	71063206	missense	probably benign	0.10
R0047:Arid4a	UTSW	12	71075419	missense	probably damaging	1.00
R0047:Arid4a	UTSW	12	71075419	missense	probably damaging	1.00
R0270:Arid4a	UTSW	12	71072632	missense	probably damaging	0.99
R0310:Arid4a	UTSW	12	71075830	missense	probably benign	0.05
R0504:Arid4a	UTSW	12	71047214	missense	probably damaging	1.00
R1061:Arid4a	UTSW	12	71074955	missense	probably damaging	1.00
R1087:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1169:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1171:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1531:Arid4a	UTSW	12	71076005	missense	probably benign	0.01
R1674:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1676:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1768:Arid4a	UTSW	12	71075338	missense	probably benign	0.01
R1833:Arid4a	UTSW	12	71075466	missense	possibly damaging	0.50
R1878:Arid4a	UTSW	12	71087589	missense	probably damaging	1.00
R2290:Arid4a	UTSW	12	71061541	missense	probably damaging	1.00
R2292:Arid4a	UTSW	12	71061541	missense	probably damaging	1.00
R2871:Arid4a	UTSW	12	71022260	critical splice donor site	probably null
R2871:Arid4a	UTSW	12	71022260	critical splice donor site	probably null
R3411:Arid4a	UTSW	12	71061525	splice site	probably benign
R3768:Arid4a	UTSW	12	71067119	missense	probably damaging	1.00
R3838:Arid4a	UTSW	12	71075785	missense	possibly damaging	0.94
R4320:Arid4a	UTSW	12	71069995	missense	possibly damaging	0.69
R4589:Arid4a	UTSW	12	71069964	missense	probably damaging	1.00
R4829:Arid4a	UTSW	12	71023498	critical splice acceptor site	probably null
R4862:Arid4a	UTSW	12	71075947	missense	probably damaging	0.96
R4952:Arid4a	UTSW	12	71023525	missense	possibly damaging	0.64
R5072:Arid4a	UTSW	12	71045079	missense	probably benign	0.08
R5423:Arid4a	UTSW	12	71069860	nonsense	probably null
R5767:Arid4a	UTSW	12	71060093	missense	probably damaging	1.00
R5911:Arid4a	UTSW	12	71069973	missense	probably damaging	1.00
R5952:Arid4a	UTSW	12	71063206	missense	probably benign	0.10
R6088:Arid4a	UTSW	12	71022236	missense	probably damaging	0.99
R6235:Arid4a	UTSW	12	71069772	splice site	probably null
R6277:Arid4a	UTSW	12	71039891	missense	possibly damaging	0.49
R6455:Arid4a	UTSW	12	71075088	missense	probably benign	0.04
R6523:Arid4a	UTSW	12	71067341	splice site	probably null
R6701:Arid4a	UTSW	12	71087512	missense	probably damaging	1.00
R6815:Arid4a	UTSW	12	71017082	splice site	probably null
R6837:Arid4a	UTSW	12	71075515	missense	probably benign
R6858:Arid4a	UTSW	12	71023509	missense	probably benign	0.01
R6895:Arid4a	UTSW	12	71063302	missense	probably benign	0.18
R6901:Arid4a	UTSW	12	71067137	missense	probably damaging	0.99
R6905:Arid4a	UTSW	12	71061544	missense	probably benign	0.43
R7387:Arid4a	UTSW	12	71087496	missense	probably damaging	1.00
R7570:Arid4a	UTSW	12	71063142	nonsense	probably null
R7772:Arid4a	UTSW	12	71061589	missense	possibly damaging	0.65
R8194:Arid4a	UTSW	12	71060115	nonsense	probably null
R8206:Arid4a	UTSW	12	71086587	missense	probably damaging	1.00
R8552:Arid4a	UTSW	12	71060075	missense	probably benign
Z1176:Arid4a	UTSW	12	71039920	missense	possibly damaging	0.89
Z1177:Arid4a	UTSW	12	71075637	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TCTACATGGTCTTCTGACTCATG -3'
(R):5'- GCCCCAGAGCAAAAGCATAG -3'

Sequencing Primer
(F):5'- ACATGGTCTTCTGACTCATGAGACC -3'
(R):5'- CGTTGACCTACCAGCTC -3'

Posted On

2018-09-12