Incidental Mutation 'R6812:F12'
ID533867
Institutional Source Beutler Lab
Gene Symbol F12
Ensembl Gene ENSMUSG00000021492
Gene Namecoagulation factor XII (Hageman factor)
SynonymsFXII
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6812 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location55417958-55426793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55421845 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 146 (E146G)
Ref Sequence ENSEMBL: ENSMUSP00000021948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021948] [ENSMUST00000170921]
Predicted Effect probably damaging
Transcript: ENSMUST00000021948
AA Change: E146G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021948
Gene: ENSMUSG00000021492
AA Change: E146G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN2 40 88 4.3e-24 SMART
EGF 97 131 4.22e-4 SMART
FN1 135 175 2.4e-13 SMART
EGF 177 210 3.94e-4 SMART
KR 215 297 6.88e-27 SMART
low complexity region 302 320 N/A INTRINSIC
Tryp_SPc 354 591 7.74e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170921
SMART Domains Protein: ENSMUSP00000125771
Gene: ENSMUSG00000021492

DomainStartEndE-ValueType
Tryp_SPc 2 137 3.4e-7 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays an important role in the intrinsic pathway of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that is autoactivated upon contact with negatively charged surfaces or misfolded protein aggregates. Mice lacking the encoded protein have a severe defect in forming stable fibrin clots. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are protected from ischemic brain injury in an experimental stroke model, without exhibiting an increase in infarct-associated hemorrhage. Another null mouse shows decreased plasma bradykinin levels and prolonged activated partial thromboplastin times. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in F12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02535:F12 APN 13 55426344 missense possibly damaging 0.83
IGL02756:F12 APN 13 55421067 missense possibly damaging 0.58
IGL03030:F12 APN 13 55421519 intron probably benign
R0049:F12 UTSW 13 55426317 missense probably benign 0.00
R0049:F12 UTSW 13 55426317 missense probably benign 0.00
R0646:F12 UTSW 13 55422483 intron probably benign
R1670:F12 UTSW 13 55421533 missense probably damaging 1.00
R1896:F12 UTSW 13 55420727 missense probably damaging 1.00
R3508:F12 UTSW 13 55421059 missense probably benign
R3548:F12 UTSW 13 55418137 missense probably benign 0.03
R3856:F12 UTSW 13 55421222 intron probably null
R4583:F12 UTSW 13 55421130 missense probably benign 0.04
R5177:F12 UTSW 13 55420168 missense probably benign 0.08
R5369:F12 UTSW 13 55418491 missense probably benign 0.13
R5529:F12 UTSW 13 55422059 missense probably benign 0.04
R5637:F12 UTSW 13 55422415 missense possibly damaging 0.57
R7156:F12 UTSW 13 55418497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAACTGAGCCTTACCTGTG -3'
(R):5'- CCACAAAGGAGGGACATGTATC -3'

Sequencing Primer
(F):5'- AAACTGAGCCTTACCTGTGTACATC -3'
(R):5'- GGAGGGACATGTATCAACACCC -3'
Posted On2018-09-12