Incidental Mutation 'R6812:Krt8'
ID 533871
Institutional Source Beutler Lab
Gene Symbol Krt8
Ensembl Gene ENSMUSG00000049382
Gene Name keratin 8
Synonyms Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6812 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 101996698-102004482 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 101997979 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 365 (A365D)
Ref Sequence ENSEMBL: ENSMUSP00000023952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023952]
AlphaFold P11679
Predicted Effect probably damaging
Transcript: ENSMUST00000023952
AA Change: A365D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: A365D

DomainStartEndE-ValueType
Pfam:Keratin_2_head 1 93 9.4e-18 PFAM
Filament 96 407 7.82e-188 SMART
low complexity region 421 438 N/A INTRINSIC
Meta Mutation Damage Score 0.8117 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Ddb1 T C 19: 10,622,499 probably null Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Krt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Krt8 APN 15 101998025 missense probably benign
IGL01643:Krt8 APN 15 101997073 missense possibly damaging 0.64
IGL01966:Krt8 APN 15 101997670 missense probably benign 0.08
IGL02587:Krt8 APN 15 101998932 missense probably benign 0.04
IGL03088:Krt8 APN 15 102000587 missense possibly damaging 0.90
R0531:Krt8 UTSW 15 102001448 missense probably benign 0.12
R1451:Krt8 UTSW 15 101998829 missense possibly damaging 0.93
R2258:Krt8 UTSW 15 101998822 missense probably benign
R2348:Krt8 UTSW 15 101998865 missense probably benign 0.31
R2566:Krt8 UTSW 15 101998024 missense probably benign 0.03
R3796:Krt8 UTSW 15 101999442 missense probably benign 0.00
R4834:Krt8 UTSW 15 101998821 missense probably damaging 1.00
R4965:Krt8 UTSW 15 101996951 missense probably benign
R5212:Krt8 UTSW 15 101997967 missense possibly damaging 0.52
R5249:Krt8 UTSW 15 101998440 missense possibly damaging 0.69
R5419:Krt8 UTSW 15 102003902 missense probably damaging 0.98
R5778:Krt8 UTSW 15 102003939 missense probably damaging 0.99
R5997:Krt8 UTSW 15 102000594 missense possibly damaging 0.77
R6503:Krt8 UTSW 15 101997934 missense possibly damaging 0.66
R6683:Krt8 UTSW 15 101998004 missense probably benign
R6824:Krt8 UTSW 15 101998440 missense possibly damaging 0.50
R6875:Krt8 UTSW 15 101997908 missense probably benign 0.44
R7650:Krt8 UTSW 15 102004163 missense probably benign 0.07
R8047:Krt8 UTSW 15 102003971 missense probably damaging 0.99
R8559:Krt8 UTSW 15 102001544 missense probably benign 0.03
R8826:Krt8 UTSW 15 102001435 missense possibly damaging 0.89
R9146:Krt8 UTSW 15 101998935 missense probably damaging 0.98
Z1177:Krt8 UTSW 15 101999435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCAAGTCCCAGGAGAGC -3'
(R):5'- TCTCCGAGATGAACCGCAAC -3'

Sequencing Primer
(F):5'- AGAGCTCCGGGCAGCAC -3'
(R):5'- GTTGCTGTAAATTCAAGGCCAGC -3'
Posted On 2018-09-12