Incidental Mutation 'R6812:Ddb1'
ID533878
Institutional Source Beutler Lab
Gene Symbol Ddb1
Ensembl Gene ENSMUSG00000024740
Gene Namedamage specific DNA binding protein 1
SynonymsDNA repair protein, p127-Ddb1, damage-specific DNA-binding protein, DNA repair
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6812 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10605625-10629813 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 10622499 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025649]
Predicted Effect probably null
Transcript: ENSMUST00000025649
SMART Domains Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740

DomainStartEndE-ValueType
Pfam:MMS1_N 75 543 1.9e-122 PFAM
low complexity region 755 775 N/A INTRINSIC
Pfam:CPSF_A 788 1099 1e-92 PFAM
Meta Mutation Damage Score 0.9592 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,795,798 probably benign Het
Ak9 A T 10: 41,367,167 M686L unknown Het
Ap3b1 A T 13: 94,479,861 T757S unknown Het
Apob A T 12: 7,983,062 K139N probably damaging Het
Arid4a A G 12: 71,047,263 E270G possibly damaging Het
Atp1a2 A T 1: 172,284,877 C515S probably benign Het
Bicd1 T C 6: 149,409,537 Y37H probably damaging Het
Birc3 T G 9: 7,854,417 D424A probably damaging Het
Ccdc97 A T 7: 25,713,044 F324L probably damaging Het
Crim1 T A 17: 78,315,600 I409N probably damaging Het
Cul7 T A 17: 46,661,409 I1233N probably benign Het
Dcaf1 T C 9: 106,858,069 S739P probably damaging Het
Dennd5b T C 6: 149,081,132 probably benign Het
Dna2 A G 10: 62,959,341 S464G probably benign Het
Dnah9 C T 11: 65,981,329 V2692M probably damaging Het
Dvl2 T C 11: 70,000,995 Y55H probably damaging Het
Eif4g3 G T 4: 138,103,376 Q140H probably damaging Het
Enpp5 G A 17: 44,085,576 V460M probably benign Het
Etv2 G T 7: 30,634,001 C265* probably null Het
F12 T C 13: 55,421,845 E146G probably damaging Het
Fdps C A 3: 89,094,476 E301D possibly damaging Het
Fsd2 G T 7: 81,535,089 H686Q probably benign Het
Gk5 T C 9: 96,150,749 S262P probably damaging Het
Gm20730 A G 6: 43,081,788 V30A probably benign Het
Gpr68 C A 12: 100,878,411 E291D probably damaging Het
Gucy2c A G 6: 136,697,995 V1006A probably benign Het
Itgb1 T A 8: 128,705,410 probably null Het
Kif2a A T 13: 106,969,751 D570E probably benign Het
Krt8 G T 15: 101,997,979 A365D probably damaging Het
Lias T A 5: 65,408,789 V373E possibly damaging Het
Mpl A G 4: 118,455,264 V169A probably benign Het
Myh3 T A 11: 67,086,402 I319N probably damaging Het
Myrfl T A 10: 116,832,913 K315I probably damaging Het
Nrap T C 19: 56,351,676 D803G probably damaging Het
Olfr1475 T C 19: 13,479,611 T196A probably benign Het
Pald1 A G 10: 61,342,922 S536P possibly damaging Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Prkaa2 T A 4: 105,047,152 T243S probably benign Het
Prrc2b T A 2: 32,213,141 V877D probably benign Het
Rbm27 T A 18: 42,333,403 probably null Het
Rbm48 A G 5: 3,596,105 V33A probably benign Het
Rev3l G T 10: 39,823,548 R1347L probably benign Het
Rnf219 A G 14: 104,510,432 V40A unknown Het
Rtp3 A G 9: 110,987,112 F124L probably benign Het
Ryr3 C T 2: 112,946,906 G302D probably damaging Het
Scnn1a A G 6: 125,337,856 N314S probably benign Het
Sik3 C T 9: 46,210,769 R907W probably damaging Het
Sox5 C T 6: 144,116,443 probably null Het
Tmc1 A C 19: 20,900,861 L90R probably damaging Het
Tmtc2 A G 10: 105,413,269 V201A probably benign Het
Uvrag T A 7: 98,888,482 H502L probably benign Het
Vwa8 T A 14: 79,197,419 I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,412,542 probably benign Het
Zfp772 T C 7: 7,206,308 D61G possibly damaging Het
Other mutations in Ddb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Ddb1 APN 19 10611664 missense possibly damaging 0.85
IGL00742:Ddb1 APN 19 10610760 missense probably benign
IGL01161:Ddb1 APN 19 10605707 start codon destroyed probably null 1.00
IGL01364:Ddb1 APN 19 10627660 critical splice donor site probably null
IGL01804:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL01812:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL02523:Ddb1 APN 19 10627632 missense probably damaging 1.00
IGL02609:Ddb1 APN 19 10622466 missense possibly damaging 0.93
IGL02664:Ddb1 APN 19 10607883 missense probably benign
IGL03033:Ddb1 APN 19 10625926 missense possibly damaging 0.59
IGL03092:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03110:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03256:Ddb1 APN 19 10621861 missense probably benign 0.01
Dubitable UTSW 19 10622499 critical splice donor site probably null
Indubitable UTSW 19 10607911 critical splice donor site probably null
Van_der_waals UTSW 19 10612916 missense probably benign 0.11
PIT4445001:Ddb1 UTSW 19 10625970 missense probably damaging 1.00
R0028:Ddb1 UTSW 19 10619246 missense probably damaging 1.00
R0589:Ddb1 UTSW 19 10621716 missense probably benign 0.02
R0893:Ddb1 UTSW 19 10612916 missense probably benign 0.11
R1374:Ddb1 UTSW 19 10608318 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10612888 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10626764 critical splice donor site probably null
R1661:Ddb1 UTSW 19 10629080 missense probably benign 0.00
R1835:Ddb1 UTSW 19 10626593 missense probably damaging 1.00
R2036:Ddb1 UTSW 19 10610822 splice site probably benign
R2094:Ddb1 UTSW 19 10612936 missense probably benign
R2142:Ddb1 UTSW 19 10619126 critical splice donor site probably null
R2213:Ddb1 UTSW 19 10608327 missense probably damaging 1.00
R2318:Ddb1 UTSW 19 10626628 missense probably damaging 1.00
R2354:Ddb1 UTSW 19 10606973 missense probably benign 0.03
R3150:Ddb1 UTSW 19 10612982 missense probably benign 0.02
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3606:Ddb1 UTSW 19 10628493 missense probably damaging 1.00
R4050:Ddb1 UTSW 19 10627807 missense probably benign 0.00
R5157:Ddb1 UTSW 19 10622364 missense probably benign 0.01
R6244:Ddb1 UTSW 19 10625923 missense probably damaging 0.99
R6249:Ddb1 UTSW 19 10605720 nonsense probably null
R7337:Ddb1 UTSW 19 10627831 missense possibly damaging 0.88
R7460:Ddb1 UTSW 19 10607911 critical splice donor site probably null
R7737:Ddb1 UTSW 19 10625974 missense possibly damaging 0.93
R7903:Ddb1 UTSW 19 10608348 missense probably benign 0.12
R7986:Ddb1 UTSW 19 10608348 missense probably benign 0.12
RF016:Ddb1 UTSW 19 10627858 missense probably damaging 1.00
X0050:Ddb1 UTSW 19 10626659 missense possibly damaging 0.95
Z1088:Ddb1 UTSW 19 10619230 missense probably damaging 0.99
Z1177:Ddb1 UTSW 19 10608396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAAGCAGCTGTTGTCCTG -3'
(R):5'- GCCCTGCAAAAGCTTTCAGATG -3'

Sequencing Primer
(F):5'- AGGTGACTTTGGGCACCCAG -3'
(R):5'- TCAGATGTTTCTAATAAAAACCCCTG -3'
Posted On2018-09-12