Incidental Mutation 'R6812:Tmc1'
ID 533880
Institutional Source Beutler Lab
Gene Symbol Tmc1
Ensembl Gene ENSMUSG00000024749
Gene Name transmembrane channel-like gene family 1
Synonyms Beethoven, Bth, 4933416G09Rik
MMRRC Submission 044924-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.152) question?
Stock # R6812 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 20760822-20931566 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 20878225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 90 (L90R)
Ref Sequence ENSEMBL: ENSMUSP00000040859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039500]
AlphaFold Q8R4P5
Predicted Effect probably damaging
Transcript: ENSMUST00000039500
AA Change: L90R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: L90R

DomainStartEndE-ValueType
SCOP:d1eq1a_ 2 95 3e-3 SMART
low complexity region 129 150 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
low complexity region 295 302 N/A INTRINSIC
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 431 453 N/A INTRINSIC
Pfam:TMC 512 627 2.6e-36 PFAM
transmembrane domain 632 654 N/A INTRINSIC
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 738 754 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 97.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 C T 16: 56,616,161 (GRCm39) probably benign Het
Ak9 A T 10: 41,243,163 (GRCm39) M686L unknown Het
Ap3b1 A T 13: 94,616,369 (GRCm39) T757S unknown Het
Apob A T 12: 8,033,062 (GRCm39) K139N probably damaging Het
Arid4a A G 12: 71,094,037 (GRCm39) E270G possibly damaging Het
Atp1a2 A T 1: 172,112,444 (GRCm39) C515S probably benign Het
Bicd1 T C 6: 149,311,035 (GRCm39) Y37H probably damaging Het
Birc2 T G 9: 7,854,418 (GRCm39) D424A probably damaging Het
Ccdc97 A T 7: 25,412,469 (GRCm39) F324L probably damaging Het
Crim1 T A 17: 78,623,029 (GRCm39) I409N probably damaging Het
Cul7 T A 17: 46,972,335 (GRCm39) I1233N probably benign Het
Dcaf1 T C 9: 106,735,268 (GRCm39) S739P probably damaging Het
Ddb1 T C 19: 10,599,863 (GRCm39) probably null Het
Dennd5b T C 6: 148,982,630 (GRCm39) probably benign Het
Dna2 A G 10: 62,795,120 (GRCm39) S464G probably benign Het
Dnah9 C T 11: 65,872,155 (GRCm39) V2692M probably damaging Het
Dvl2 T C 11: 69,891,821 (GRCm39) Y55H probably damaging Het
Eif4g3 G T 4: 137,830,687 (GRCm39) Q140H probably damaging Het
Enpp5 G A 17: 44,396,467 (GRCm39) V460M probably benign Het
Etv2 G T 7: 30,333,426 (GRCm39) C265* probably null Het
F12 T C 13: 55,569,658 (GRCm39) E146G probably damaging Het
Fdps C A 3: 89,001,783 (GRCm39) E301D possibly damaging Het
Fsd2 G T 7: 81,184,837 (GRCm39) H686Q probably benign Het
Gk5 T C 9: 96,032,802 (GRCm39) S262P probably damaging Het
Gm20730 A G 6: 43,058,722 (GRCm39) V30A probably benign Het
Gpr68 C A 12: 100,844,670 (GRCm39) E291D probably damaging Het
Gucy2c A G 6: 136,674,993 (GRCm39) V1006A probably benign Het
Itgb1 T A 8: 129,431,891 (GRCm39) probably null Het
Kif2a A T 13: 107,106,259 (GRCm39) D570E probably benign Het
Krt8 G T 15: 101,906,414 (GRCm39) A365D probably damaging Het
Lias T A 5: 65,566,132 (GRCm39) V373E possibly damaging Het
Mpl A G 4: 118,312,461 (GRCm39) V169A probably benign Het
Myh3 T A 11: 66,977,228 (GRCm39) I319N probably damaging Het
Myrfl T A 10: 116,668,818 (GRCm39) K315I probably damaging Het
Nrap T C 19: 56,340,108 (GRCm39) D803G probably damaging Het
Obi1 A G 14: 104,747,868 (GRCm39) V40A unknown Het
Or5b119 T C 19: 13,456,975 (GRCm39) T196A probably benign Het
Pald1 A G 10: 61,178,701 (GRCm39) S536P possibly damaging Het
Phka2 G A X: 159,316,044 (GRCm39) V230I probably damaging Het
Prkaa2 T A 4: 104,904,349 (GRCm39) T243S probably benign Het
Prrc2b T A 2: 32,103,153 (GRCm39) V877D probably benign Het
Rbm27 T A 18: 42,466,468 (GRCm39) probably null Het
Rbm48 A G 5: 3,646,105 (GRCm39) V33A probably benign Het
Rev3l G T 10: 39,699,544 (GRCm39) R1347L probably benign Het
Rtp3 A G 9: 110,816,180 (GRCm39) F124L probably benign Het
Ryr3 C T 2: 112,777,251 (GRCm39) G302D probably damaging Het
Scnn1a A G 6: 125,314,819 (GRCm39) N314S probably benign Het
Sik3 C T 9: 46,122,067 (GRCm39) R907W probably damaging Het
Sox5 C T 6: 144,062,169 (GRCm39) probably null Het
Tmtc2 A G 10: 105,249,130 (GRCm39) V201A probably benign Het
Uvrag T A 7: 98,537,689 (GRCm39) H502L probably benign Het
Vwa8 T A 14: 79,434,859 (GRCm39) I1760N probably damaging Het
Zfp318 G GAAGAAT 17: 46,723,468 (GRCm39) probably benign Het
Zfp772 T C 7: 7,209,307 (GRCm39) D61G possibly damaging Het
Other mutations in Tmc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Tmc1 APN 19 20,793,556 (GRCm39) missense probably damaging 1.00
IGL02104:Tmc1 APN 19 20,809,818 (GRCm39) missense probably benign 0.00
IGL02245:Tmc1 APN 19 20,776,556 (GRCm39) missense probably damaging 1.00
IGL02544:Tmc1 APN 19 20,884,327 (GRCm39) missense probably benign 0.04
IGL02699:Tmc1 APN 19 20,809,714 (GRCm39) critical splice donor site probably null
IGL02974:Tmc1 APN 19 20,878,208 (GRCm39) missense probably benign
IGL03194:Tmc1 APN 19 20,782,017 (GRCm39) missense probably damaging 1.00
dinner_bell UTSW 19 20,772,880 (GRCm39) missense probably damaging 0.99
R0255:Tmc1 UTSW 19 20,766,951 (GRCm39) missense possibly damaging 0.93
R0381:Tmc1 UTSW 19 20,776,409 (GRCm39) missense probably damaging 1.00
R0655:Tmc1 UTSW 19 20,776,540 (GRCm39) missense probably damaging 1.00
R1404:Tmc1 UTSW 19 20,793,548 (GRCm39) missense possibly damaging 0.79
R1404:Tmc1 UTSW 19 20,793,548 (GRCm39) missense possibly damaging 0.79
R1496:Tmc1 UTSW 19 20,845,719 (GRCm39) missense probably damaging 1.00
R1542:Tmc1 UTSW 19 20,793,486 (GRCm39) missense probably damaging 1.00
R1773:Tmc1 UTSW 19 20,803,865 (GRCm39) splice site probably null
R1777:Tmc1 UTSW 19 20,793,473 (GRCm39) critical splice donor site probably null
R2067:Tmc1 UTSW 19 20,801,673 (GRCm39) missense possibly damaging 0.90
R2152:Tmc1 UTSW 19 20,834,039 (GRCm39) missense probably benign 0.01
R2180:Tmc1 UTSW 19 20,801,448 (GRCm39) missense probably damaging 0.96
R2204:Tmc1 UTSW 19 20,918,269 (GRCm39) missense probably benign 0.01
R2205:Tmc1 UTSW 19 20,918,269 (GRCm39) missense probably benign 0.01
R2285:Tmc1 UTSW 19 20,767,163 (GRCm39) missense probably damaging 0.96
R4505:Tmc1 UTSW 19 20,845,738 (GRCm39) missense probably benign 0.00
R4752:Tmc1 UTSW 19 20,804,013 (GRCm39) missense probably benign 0.35
R4975:Tmc1 UTSW 19 20,884,319 (GRCm39) missense probably damaging 0.96
R5040:Tmc1 UTSW 19 20,801,394 (GRCm39) missense possibly damaging 0.68
R5206:Tmc1 UTSW 19 20,804,024 (GRCm39) missense probably damaging 1.00
R5400:Tmc1 UTSW 19 20,781,966 (GRCm39) missense probably damaging 1.00
R5429:Tmc1 UTSW 19 20,766,986 (GRCm39) missense possibly damaging 0.72
R6200:Tmc1 UTSW 19 20,766,954 (GRCm39) missense possibly damaging 0.53
R6784:Tmc1 UTSW 19 20,805,015 (GRCm39) critical splice donor site probably null
R6796:Tmc1 UTSW 19 20,776,400 (GRCm39) missense probably damaging 1.00
R6808:Tmc1 UTSW 19 20,772,880 (GRCm39) missense probably damaging 0.99
R6834:Tmc1 UTSW 19 20,772,974 (GRCm39) nonsense probably null
R6978:Tmc1 UTSW 19 20,781,999 (GRCm39) missense probably damaging 1.00
R6986:Tmc1 UTSW 19 20,801,647 (GRCm39) missense probably benign 0.02
R7027:Tmc1 UTSW 19 20,918,267 (GRCm39) critical splice donor site probably null
R7378:Tmc1 UTSW 19 20,845,753 (GRCm39) missense probably damaging 0.98
R7520:Tmc1 UTSW 19 20,776,542 (GRCm39) missense probably damaging 0.99
R7573:Tmc1 UTSW 19 20,884,372 (GRCm39) missense probably damaging 0.98
R7825:Tmc1 UTSW 19 20,782,009 (GRCm39) missense possibly damaging 0.55
R8024:Tmc1 UTSW 19 20,878,181 (GRCm39) missense probably damaging 1.00
R8073:Tmc1 UTSW 19 20,845,725 (GRCm39) missense probably benign 0.08
R8786:Tmc1 UTSW 19 20,803,953 (GRCm39) missense probably damaging 1.00
R8791:Tmc1 UTSW 19 20,767,209 (GRCm39) missense probably benign 0.00
R8969:Tmc1 UTSW 19 20,793,593 (GRCm39) missense probably damaging 1.00
R8973:Tmc1 UTSW 19 20,878,215 (GRCm39) missense probably benign
R9429:Tmc1 UTSW 19 20,793,548 (GRCm39) missense possibly damaging 0.79
R9493:Tmc1 UTSW 19 20,801,644 (GRCm39) missense probably benign 0.00
Z1176:Tmc1 UTSW 19 20,803,870 (GRCm39) missense probably null 1.00
Z1177:Tmc1 UTSW 19 20,801,346 (GRCm39) missense probably damaging 1.00
Z1177:Tmc1 UTSW 19 20,772,972 (GRCm39) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CAAATCCCTCTAGCTTGTGCATAC -3'
(R):5'- AGCCCGATTGCAAGTGTTG -3'

Sequencing Primer
(F):5'- CCTCTAGCTTGTGCATACATGAGG -3'
(R):5'- TATCTGACAGGCGTCCTT -3'
Posted On 2018-09-12