Mutagenetix > Incidental Mutations

Incidental Mutation 'R6812:Tmc1'

533880

Institutional Source

Beutler Lab

Gene Symbol

Tmc1

Ensembl Gene

ENSMUSG00000024749

Gene Name

transmembrane channel-like gene family 1

Synonyms

4933416G09Rik, Beethoven, Bth

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.075) question?

Stock #

R6812 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20783458-20954202 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 20900861 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 90 (L90R)

Ref Sequence

ENSEMBL: ENSMUSP00000040859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039500]

AlphaFold

Q8R4P5

Predicted Effect

probably damaging
Transcript: ENSMUST00000039500
AA Change: L90R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: L90R

Domain	Start	End	E-Value	Type
SCOP:d1eq1a_	2	95	3e-3	SMART
low complexity region	129	150	N/A	INTRINSIC
transmembrane domain	184	206	N/A	INTRINSIC
transmembrane domain	265	287	N/A	INTRINSIC
low complexity region	295	302	N/A	INTRINSIC
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
Pfam:TMC	512	627	2.6e-36	PFAM
transmembrane domain	632	654	N/A	INTRINSIC
transmembrane domain	693	715	N/A	INTRINSIC
low complexity region	738	754	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.0%
20x: 97.4%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg7	C	T	16: 56,795,798		probably benign	Het
Ak9	A	T	10: 41,367,167	M686L	unknown	Het
Ap3b1	A	T	13: 94,479,861	T757S	unknown	Het
Apob	A	T	12: 7,983,062	K139N	probably damaging	Het
Arid4a	A	G	12: 71,047,263	E270G	possibly damaging	Het
Atp1a2	A	T	1: 172,284,877	C515S	probably benign	Het
Bicd1	T	C	6: 149,409,537	Y37H	probably damaging	Het
Birc3	T	G	9: 7,854,417	D424A	probably damaging	Het
Ccdc97	A	T	7: 25,713,044	F324L	probably damaging	Het
Crim1	T	A	17: 78,315,600	I409N	probably damaging	Het
Cul7	T	A	17: 46,661,409	I1233N	probably benign	Het
Dcaf1	T	C	9: 106,858,069	S739P	probably damaging	Het
Ddb1	T	C	19: 10,622,499		probably null	Het
Dennd5b	T	C	6: 149,081,132		probably benign	Het
Dna2	A	G	10: 62,959,341	S464G	probably benign	Het
Dnah9	C	T	11: 65,981,329	V2692M	probably damaging	Het
Dvl2	T	C	11: 70,000,995	Y55H	probably damaging	Het
Eif4g3	G	T	4: 138,103,376	Q140H	probably damaging	Het
Enpp5	G	A	17: 44,085,576	V460M	probably benign	Het
Etv2	G	T	7: 30,634,001	C265*	probably null	Het
F12	T	C	13: 55,421,845	E146G	probably damaging	Het
Fdps	C	A	3: 89,094,476	E301D	possibly damaging	Het
Fsd2	G	T	7: 81,535,089	H686Q	probably benign	Het
Gk5	T	C	9: 96,150,749	S262P	probably damaging	Het
Gm20730	A	G	6: 43,081,788	V30A	probably benign	Het
Gpr68	C	A	12: 100,878,411	E291D	probably damaging	Het
Gucy2c	A	G	6: 136,697,995	V1006A	probably benign	Het
Itgb1	T	A	8: 128,705,410		probably null	Het
Kif2a	A	T	13: 106,969,751	D570E	probably benign	Het
Krt8	G	T	15: 101,997,979	A365D	probably damaging	Het
Lias	T	A	5: 65,408,789	V373E	possibly damaging	Het
Mpl	A	G	4: 118,455,264	V169A	probably benign	Het
Myh3	T	A	11: 67,086,402	I319N	probably damaging	Het
Myrfl	T	A	10: 116,832,913	K315I	probably damaging	Het
Nrap	T	C	19: 56,351,676	D803G	probably damaging	Het
Olfr1475	T	C	19: 13,479,611	T196A	probably benign	Het
Pald1	A	G	10: 61,342,922	S536P	possibly damaging	Het
Phka2	G	A	X: 160,533,048	V230I	probably damaging	Het
Prkaa2	T	A	4: 105,047,152	T243S	probably benign	Het
Prrc2b	T	A	2: 32,213,141	V877D	probably benign	Het
Rbm27	T	A	18: 42,333,403		probably null	Het
Rbm48	A	G	5: 3,596,105	V33A	probably benign	Het
Rev3l	G	T	10: 39,823,548	R1347L	probably benign	Het
Rnf219	A	G	14: 104,510,432	V40A	unknown	Het
Rtp3	A	G	9: 110,987,112	F124L	probably benign	Het
Ryr3	C	T	2: 112,946,906	G302D	probably damaging	Het
Scnn1a	A	G	6: 125,337,856	N314S	probably benign	Het
Sik3	C	T	9: 46,210,769	R907W	probably damaging	Het
Sox5	C	T	6: 144,116,443		probably null	Het
Tmtc2	A	G	10: 105,413,269	V201A	probably benign	Het
Uvrag	T	A	7: 98,888,482	H502L	probably benign	Het
Vwa8	T	A	14: 79,197,419	I1760N	probably damaging	Het
Zfp318	G	GAAGAAT	17: 46,412,542		probably benign	Het
Zfp772	T	C	7: 7,206,308	D61G	possibly damaging	Het

Other mutations in Tmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Tmc1	APN	19	20816192	missense	probably damaging	1.00
IGL02104:Tmc1	APN	19	20832454	missense	probably benign	0.00
IGL02245:Tmc1	APN	19	20799192	missense	probably damaging	1.00
IGL02544:Tmc1	APN	19	20906963	missense	probably benign	0.04
IGL02699:Tmc1	APN	19	20832350	critical splice donor site	probably null
IGL02974:Tmc1	APN	19	20900844	missense	probably benign
IGL03194:Tmc1	APN	19	20804653	missense	probably damaging	1.00
dinner_bell	UTSW	19	20795516	missense	probably damaging	0.99
R0255:Tmc1	UTSW	19	20789587	missense	possibly damaging	0.93
R0381:Tmc1	UTSW	19	20799045	missense	probably damaging	1.00
R0655:Tmc1	UTSW	19	20799176	missense	probably damaging	1.00
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1496:Tmc1	UTSW	19	20868355	missense	probably damaging	1.00
R1542:Tmc1	UTSW	19	20816122	missense	probably damaging	1.00
R1773:Tmc1	UTSW	19	20826501	splice site	probably null
R1777:Tmc1	UTSW	19	20816109	critical splice donor site	probably null
R2067:Tmc1	UTSW	19	20824309	missense	possibly damaging	0.90
R2152:Tmc1	UTSW	19	20856675	missense	probably benign	0.01
R2180:Tmc1	UTSW	19	20824084	missense	probably damaging	0.96
R2204:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2205:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2285:Tmc1	UTSW	19	20789799	missense	probably damaging	0.96
R4505:Tmc1	UTSW	19	20868374	missense	probably benign	0.00
R4752:Tmc1	UTSW	19	20826649	missense	probably benign	0.35
R4975:Tmc1	UTSW	19	20906955	missense	probably damaging	0.96
R5040:Tmc1	UTSW	19	20824030	missense	possibly damaging	0.68
R5206:Tmc1	UTSW	19	20826660	missense	probably damaging	1.00
R5400:Tmc1	UTSW	19	20804602	missense	probably damaging	1.00
R5429:Tmc1	UTSW	19	20789622	missense	possibly damaging	0.72
R6200:Tmc1	UTSW	19	20789590	missense	possibly damaging	0.53
R6784:Tmc1	UTSW	19	20827651	critical splice donor site	probably null
R6796:Tmc1	UTSW	19	20799036	missense	probably damaging	1.00
R6808:Tmc1	UTSW	19	20795516	missense	probably damaging	0.99
R6834:Tmc1	UTSW	19	20795610	nonsense	probably null
R6978:Tmc1	UTSW	19	20804635	missense	probably damaging	1.00
R6986:Tmc1	UTSW	19	20824283	missense	probably benign	0.02
R7027:Tmc1	UTSW	19	20940903	critical splice donor site	probably null
R7378:Tmc1	UTSW	19	20868389	missense	probably damaging	0.98
R7520:Tmc1	UTSW	19	20799178	missense	probably damaging	0.99
R7573:Tmc1	UTSW	19	20907008	missense	probably damaging	0.98
R7825:Tmc1	UTSW	19	20804645	missense	possibly damaging	0.55
R8024:Tmc1	UTSW	19	20900817	missense	probably damaging	1.00
R8073:Tmc1	UTSW	19	20868361	missense	probably benign	0.08
R8786:Tmc1	UTSW	19	20826589	missense	probably damaging	1.00
R8791:Tmc1	UTSW	19	20789845	missense	probably benign	0.00
R8969:Tmc1	UTSW	19	20816229	missense	probably damaging	1.00
R8973:Tmc1	UTSW	19	20900851	missense	probably benign
R9429:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
Z1176:Tmc1	UTSW	19	20826506	missense	probably null	1.00
Z1177:Tmc1	UTSW	19	20795608	missense	possibly damaging	0.47
Z1177:Tmc1	UTSW	19	20823982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAATCCCTCTAGCTTGTGCATAC -3'
(R):5'- AGCCCGATTGCAAGTGTTG -3'

Sequencing Primer
(F):5'- CCTCTAGCTTGTGCATACATGAGG -3'
(R):5'- TATCTGACAGGCGTCCTT -3'

Posted On

2018-09-12