Incidental Mutation 'R6842:Mme'
ID533890
Institutional Source Beutler Lab
Gene Symbol Mme
Ensembl Gene ENSMUSG00000027820
Gene Namemembrane metallo endopeptidase
SynonymsCD10, neprilysin, NEP, neutral endopeptidase, 6030454K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6842 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location63241537-63386030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63362044 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 591 (D591E)
Ref Sequence ENSEMBL: ENSMUSP00000141544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029400] [ENSMUST00000194134] [ENSMUST00000194150]
Predicted Effect probably damaging
Transcript: ENSMUST00000029400
AA Change: D591E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029400
Gene: ENSMUSG00000027820
AA Change: D591E

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.7e-103 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 5.8e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194134
AA Change: D591E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142205
Gene: ENSMUSG00000027820
AA Change: D591E

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194150
AA Change: D591E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141544
Gene: ENSMUSG00000027820
AA Change: D591E

DomainStartEndE-ValueType
PDB:2YVC|F 2 23 5e-7 PDB
transmembrane domain 29 51 N/A INTRINSIC
Pfam:Peptidase_M13_N 80 483 8.4e-134 PFAM
low complexity region 489 507 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:Peptidase_M13 543 749 3.3e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common acute lymphocytic leukemia antigen that is an important cell surface marker in the diagnosis of human acute lymphocytic leukemia (ALL). This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. This protein is not restricted to leukemic cells, however, and is found on a variety of normal tissues. It is a glycoprotein that is particularly abundant in kidney, where it is present on the brush border of proximal tubules and on glomerular epithelium. The protein is a neutral endopeptidase that cleaves peptides at the amino side of hydrophobic residues and inactivates several peptide hormones including glucagon, enkephalins, substance P, neurotensin, oxytocin, and bradykinin. This gene, which encodes a 100-kD type II transmembrane glycoprotein, exists in a single copy of greater than 45 kb. The 5' untranslated region of this gene is alternatively spliced, resulting in four separate mRNA transcripts. The coding region is not affected by alternative splicing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced allergic contact dermatitis responses, diffuse hepatic necrosis after LPS shock or treatment with a combination of TNF and interleukin-1 beta, and increased brain and plasma amyloid beta peptide levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,432 N69S probably benign Het
9130011E15Rik A G 19: 45,818,977 V660A probably benign Het
Adgrl3 C T 5: 81,741,080 A1042V probably damaging Het
Armc4 C T 18: 7,268,401 D373N probably benign Het
C1s2 T A 6: 124,627,502 H395L probably benign Het
Cacna1e A G 1: 154,483,117 I307T probably damaging Het
Cap2 T C 13: 46,646,625 S381P probably damaging Het
Cbfa2t2 A G 2: 154,524,045 T392A probably benign Het
Ccdc127 T C 13: 74,356,969 I212T probably damaging Het
Cela3a A G 4: 137,405,668 V91A probably benign Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Csmd2 T C 4: 128,509,159 F2347L possibly damaging Het
Ddx19a A G 8: 110,978,625 V288A possibly damaging Het
Fbxl5 T C 5: 43,773,586 E53G probably damaging Het
Fbxw26 A T 9: 109,724,920 I217N probably damaging Het
Fgfr1op2 T A 6: 146,590,038 probably null Het
Ighv1-37 A T 12: 114,896,655 I6N probably damaging Het
Klhdc10 T C 6: 30,439,782 L128P probably damaging Het
Lypla1 C T 1: 4,832,340 S24F probably benign Het
Mmp1b T A 9: 7,384,888 I254F probably damaging Het
Msr1 T C 8: 39,632,825 M5V probably benign Het
Myh8 A G 11: 67,284,655 D312G probably damaging Het
Nav2 T C 7: 49,458,169 Y709H possibly damaging Het
Oas1g T C 5: 120,887,558 E2G probably benign Het
Ocm T A 5: 144,025,691 I6F unknown Het
Olfr160 T C 9: 37,711,589 N230S probably benign Het
Olfr275 T C 4: 52,825,576 Y60H probably damaging Het
Olfr693 T C 7: 106,677,886 Y200C probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pax1 A G 2: 147,373,720 D419G probably benign Het
Plbd1 T A 6: 136,635,614 I194F probably benign Het
Prdx6 A T 1: 161,247,370 C47S probably damaging Het
Sec24d T C 3: 123,343,219 S534P probably benign Het
Sgk3 T C 1: 9,898,754 V452A probably benign Het
Sipa1l1 T C 12: 82,420,546 V1177A probably benign Het
Tgfbr1 T C 4: 47,383,757 C32R probably damaging Het
Trim66 T C 7: 109,460,776 N801S probably benign Het
Utp6 C T 11: 79,940,949 S504N probably benign Het
Wdsub1 A C 2: 59,878,188 S114A probably benign Het
Wfikkn2 T C 11: 94,238,040 E425G probably damaging Het
Zfp956 C T 6: 47,963,829 T374I possibly damaging Het
Other mutations in Mme
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mme APN 3 63340044 missense possibly damaging 0.95
IGL00329:Mme APN 3 63380328 nonsense probably null
IGL01013:Mme APN 3 63327860 unclassified probably null
IGL01316:Mme APN 3 63340159 splice site probably benign
IGL01333:Mme APN 3 63346091 missense probably damaging 1.00
IGL01392:Mme APN 3 63362046 missense probably damaging 1.00
IGL01566:Mme APN 3 63361929 splice site probably benign
IGL01739:Mme APN 3 63340113 missense possibly damaging 0.78
IGL01996:Mme APN 3 63343549 missense probably benign 0.11
IGL02125:Mme APN 3 63348649 missense probably damaging 1.00
IGL02154:Mme APN 3 63343555 missense probably benign
IGL03214:Mme APN 3 63329690 missense possibly damaging 0.72
IGL03291:Mme APN 3 63346104 missense probably benign 0.00
R0498:Mme UTSW 3 63346066 missense probably damaging 1.00
R0595:Mme UTSW 3 63328181 missense probably benign 0.27
R0980:Mme UTSW 3 63340129 missense probably benign
R1210:Mme UTSW 3 63343606 missense probably benign 0.01
R1600:Mme UTSW 3 63365058 missense probably damaging 1.00
R1852:Mme UTSW 3 63327983 missense probably benign 0.31
R1852:Mme UTSW 3 63328046 missense probably benign 0.00
R2037:Mme UTSW 3 63328260 missense probably null 1.00
R2177:Mme UTSW 3 63301005 missense probably benign 0.02
R2200:Mme UTSW 3 63380292 missense possibly damaging 0.87
R2306:Mme UTSW 3 63300252 missense probably benign 0.00
R2847:Mme UTSW 3 63345199 missense possibly damaging 0.91
R3008:Mme UTSW 3 63358957 missense probably damaging 1.00
R3749:Mme UTSW 3 63343540 missense probably damaging 1.00
R3876:Mme UTSW 3 63362059 splice site probably benign
R3961:Mme UTSW 3 63345192 missense probably damaging 1.00
R3981:Mme UTSW 3 63328064 missense probably damaging 1.00
R3982:Mme UTSW 3 63328064 missense probably damaging 1.00
R3983:Mme UTSW 3 63328064 missense probably damaging 1.00
R4494:Mme UTSW 3 63347192 missense probably benign
R4589:Mme UTSW 3 63380272 missense probably benign
R4706:Mme UTSW 3 63348712 missense possibly damaging 0.92
R4871:Mme UTSW 3 63340032 missense probably benign 0.01
R4957:Mme UTSW 3 63343489 splice site probably benign
R5053:Mme UTSW 3 63364849 missense probably damaging 1.00
R5316:Mme UTSW 3 63368954 missense probably damaging 1.00
R5502:Mme UTSW 3 63300281 nonsense probably null
R5579:Mme UTSW 3 63348645 missense probably damaging 1.00
R6007:Mme UTSW 3 63343508 nonsense probably null
R6022:Mme UTSW 3 63364797 missense probably damaging 1.00
R6143:Mme UTSW 3 63300111 splice site probably null
R6154:Mme UTSW 3 63300253 missense probably damaging 0.98
R6333:Mme UTSW 3 63341961 missense probably benign 0.00
R6476:Mme UTSW 3 63343635 critical splice donor site probably null
R6514:Mme UTSW 3 63364844 nonsense probably null
R6711:Mme UTSW 3 63341918 missense possibly damaging 0.93
R6996:Mme UTSW 3 63346102 missense possibly damaging 0.63
R7040:Mme UTSW 3 63368923 missense probably damaging 1.00
R7043:Mme UTSW 3 63345217 nonsense probably null
R7084:Mme UTSW 3 63328217 missense probably damaging 0.98
R7126:Mme UTSW 3 63368901 missense probably damaging 0.97
R7783:Mme UTSW 3 63364867 missense probably damaging 1.00
X0058:Mme UTSW 3 63365021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAGTGACAATGCCATTGC -3'
(R):5'- TGCCTCAGTACAGGGGAAAG -3'

Sequencing Primer
(F):5'- CAGTGACAATGCCATTGCTAATC -3'
(R):5'- CTGACTACGTACTTAGACTTAATT -3'
Posted On2018-09-12