Incidental Mutation 'R6842:Plbd1'
ID533904
Institutional Source Beutler Lab
Gene Symbol Plbd1
Ensembl Gene ENSMUSG00000030214
Gene Namephospholipase B domain containing 1
Synonyms1100001H23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6842 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location136612070-136661928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136635614 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 194 (I194F)
Ref Sequence ENSEMBL: ENSMUSP00000032336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032336]
Predicted Effect probably benign
Transcript: ENSMUST00000032336
AA Change: I194F

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032336
Gene: ENSMUSG00000030214
AA Change: I194F

DomainStartEndE-ValueType
Pfam:Phospholip_B 16 545 3.7e-198 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,432 N69S probably benign Het
9130011E15Rik A G 19: 45,818,977 V660A probably benign Het
Adgrl3 C T 5: 81,741,080 A1042V probably damaging Het
Armc4 C T 18: 7,268,401 D373N probably benign Het
C1s2 T A 6: 124,627,502 H395L probably benign Het
Cacna1e A G 1: 154,483,117 I307T probably damaging Het
Cap2 T C 13: 46,646,625 S381P probably damaging Het
Cbfa2t2 A G 2: 154,524,045 T392A probably benign Het
Ccdc127 T C 13: 74,356,969 I212T probably damaging Het
Cela3a A G 4: 137,405,668 V91A probably benign Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Csmd2 T C 4: 128,509,159 F2347L possibly damaging Het
Ddx19a A G 8: 110,978,625 V288A possibly damaging Het
Fbxl5 T C 5: 43,773,586 E53G probably damaging Het
Fbxw26 A T 9: 109,724,920 I217N probably damaging Het
Fgfr1op2 T A 6: 146,590,038 probably null Het
Ighv1-37 A T 12: 114,896,655 I6N probably damaging Het
Klhdc10 T C 6: 30,439,782 L128P probably damaging Het
Lypla1 C T 1: 4,832,340 S24F probably benign Het
Mme T A 3: 63,362,044 D591E probably damaging Het
Mmp1b T A 9: 7,384,888 I254F probably damaging Het
Msr1 T C 8: 39,632,825 M5V probably benign Het
Myh8 A G 11: 67,284,655 D312G probably damaging Het
Nav2 T C 7: 49,458,169 Y709H possibly damaging Het
Oas1g T C 5: 120,887,558 E2G probably benign Het
Ocm T A 5: 144,025,691 I6F unknown Het
Olfr160 T C 9: 37,711,589 N230S probably benign Het
Olfr275 T C 4: 52,825,576 Y60H probably damaging Het
Olfr693 T C 7: 106,677,886 Y200C probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pax1 A G 2: 147,373,720 D419G probably benign Het
Prdx6 A T 1: 161,247,370 C47S probably damaging Het
Sec24d T C 3: 123,343,219 S534P probably benign Het
Sgk3 T C 1: 9,898,754 V452A probably benign Het
Sipa1l1 T C 12: 82,420,546 V1177A probably benign Het
Tgfbr1 T C 4: 47,383,757 C32R probably damaging Het
Trim66 T C 7: 109,460,776 N801S probably benign Het
Utp6 C T 11: 79,940,949 S504N probably benign Het
Wdsub1 A C 2: 59,878,188 S114A probably benign Het
Wfikkn2 T C 11: 94,238,040 E425G probably damaging Het
Zfp956 C T 6: 47,963,829 T374I possibly damaging Het
Other mutations in Plbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Plbd1 APN 6 136634470 missense probably benign
IGL02131:Plbd1 APN 6 136661683 utr 5 prime probably benign
R0355:Plbd1 UTSW 6 136641167 missense possibly damaging 0.71
R0762:Plbd1 UTSW 6 136641147 missense probably damaging 1.00
R1019:Plbd1 UTSW 6 136651905 missense probably benign 0.03
R1456:Plbd1 UTSW 6 136613816 missense probably benign 0.12
R1607:Plbd1 UTSW 6 136612306 missense probably benign 0.04
R1640:Plbd1 UTSW 6 136640125 missense probably benign 0.00
R2166:Plbd1 UTSW 6 136613790 critical splice donor site probably null
R2909:Plbd1 UTSW 6 136634574 missense probably damaging 1.00
R4494:Plbd1 UTSW 6 136613858 missense probably damaging 1.00
R4529:Plbd1 UTSW 6 136651825 missense probably benign 0.04
R4530:Plbd1 UTSW 6 136651825 missense probably benign 0.04
R5206:Plbd1 UTSW 6 136641156 missense probably benign 0.17
R5272:Plbd1 UTSW 6 136640158 missense probably damaging 1.00
R5522:Plbd1 UTSW 6 136617300 missense probably benign 0.31
R5649:Plbd1 UTSW 6 136616989 missense probably benign 0.01
R5879:Plbd1 UTSW 6 136634505 missense probably damaging 1.00
R5940:Plbd1 UTSW 6 136613721 intron probably benign
R6311:Plbd1 UTSW 6 136613947 missense probably benign 0.09
R6590:Plbd1 UTSW 6 136635600 missense probably damaging 1.00
R6657:Plbd1 UTSW 6 136617252 missense probably damaging 0.99
R6690:Plbd1 UTSW 6 136635600 missense probably damaging 1.00
R6938:Plbd1 UTSW 6 136616987 missense probably benign 0.00
R7000:Plbd1 UTSW 6 136612838 missense probably benign 0.21
R7214:Plbd1 UTSW 6 136612831 missense probably damaging 1.00
R7654:Plbd1 UTSW 6 136651866 missense possibly damaging 0.47
R7744:Plbd1 UTSW 6 136617246 missense probably benign 0.00
R7870:Plbd1 UTSW 6 136617328 missense possibly damaging 0.81
R7953:Plbd1 UTSW 6 136617328 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGTACCATAACATCCAGCCAGG -3'
(R):5'- ACTAGTAGAAATTCTGTCCCCACAC -3'

Sequencing Primer
(F):5'- GGTGTATGAAGAACATATGCCAATAC -3'
(R):5'- GTAGAAATTCTGTCCCCACACAAATG -3'
Posted On2018-09-12