Incidental Mutation 'R6842:Olfr693'
ID533907
Institutional Source Beutler Lab
Gene Symbol Olfr693
Ensembl Gene ENSMUSG00000051680
Gene Nameolfactory receptor 693
SynonymsGA_x6K02T2PBJ9-9055944-9054994, MOR283-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6842 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location106675005-106680584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106677886 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 200 (Y200C)
Ref Sequence ENSEMBL: ENSMUSP00000150203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057817] [ENSMUST00000215541]
Predicted Effect probably damaging
Transcript: ENSMUST00000057817
AA Change: Y200C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059679
Gene: ENSMUSG00000051680
AA Change: Y200C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.2e-48 PFAM
Pfam:7tm_1 41 290 5.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215541
AA Change: Y200C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,432 N69S probably benign Het
9130011E15Rik A G 19: 45,818,977 V660A probably benign Het
Adgrl3 C T 5: 81,741,080 A1042V probably damaging Het
Armc4 C T 18: 7,268,401 D373N probably benign Het
C1s2 T A 6: 124,627,502 H395L probably benign Het
Cacna1e A G 1: 154,483,117 I307T probably damaging Het
Cap2 T C 13: 46,646,625 S381P probably damaging Het
Cbfa2t2 A G 2: 154,524,045 T392A probably benign Het
Ccdc127 T C 13: 74,356,969 I212T probably damaging Het
Cela3a A G 4: 137,405,668 V91A probably benign Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Csmd2 T C 4: 128,509,159 F2347L possibly damaging Het
Ddx19a A G 8: 110,978,625 V288A possibly damaging Het
Fbxl5 T C 5: 43,773,586 E53G probably damaging Het
Fbxw26 A T 9: 109,724,920 I217N probably damaging Het
Fgfr1op2 T A 6: 146,590,038 probably null Het
Ighv1-37 A T 12: 114,896,655 I6N probably damaging Het
Klhdc10 T C 6: 30,439,782 L128P probably damaging Het
Lypla1 C T 1: 4,832,340 S24F probably benign Het
Mme T A 3: 63,362,044 D591E probably damaging Het
Mmp1b T A 9: 7,384,888 I254F probably damaging Het
Msr1 T C 8: 39,632,825 M5V probably benign Het
Myh8 A G 11: 67,284,655 D312G probably damaging Het
Nav2 T C 7: 49,458,169 Y709H possibly damaging Het
Oas1g T C 5: 120,887,558 E2G probably benign Het
Ocm T A 5: 144,025,691 I6F unknown Het
Olfr160 T C 9: 37,711,589 N230S probably benign Het
Olfr275 T C 4: 52,825,576 Y60H probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pax1 A G 2: 147,373,720 D419G probably benign Het
Plbd1 T A 6: 136,635,614 I194F probably benign Het
Prdx6 A T 1: 161,247,370 C47S probably damaging Het
Sec24d T C 3: 123,343,219 S534P probably benign Het
Sgk3 T C 1: 9,898,754 V452A probably benign Het
Sipa1l1 T C 12: 82,420,546 V1177A probably benign Het
Tgfbr1 T C 4: 47,383,757 C32R probably damaging Het
Trim66 T C 7: 109,460,776 N801S probably benign Het
Utp6 C T 11: 79,940,949 S504N probably benign Het
Wdsub1 A C 2: 59,878,188 S114A probably benign Het
Wfikkn2 T C 11: 94,238,040 E425G probably damaging Het
Zfp956 C T 6: 47,963,829 T374I possibly damaging Het
Other mutations in Olfr693
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Olfr693 APN 7 106677833 missense probably damaging 1.00
IGL01135:Olfr693 APN 7 106678193 missense probably benign 0.41
IGL03247:Olfr693 APN 7 106677547 missense probably benign 0.01
R0206:Olfr693 UTSW 7 106677574 missense probably benign 0.03
R1125:Olfr693 UTSW 7 106678007 missense possibly damaging 0.46
R1873:Olfr693 UTSW 7 106678484 start codon destroyed probably damaging 1.00
R1969:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1970:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1971:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1972:Olfr693 UTSW 7 106678219 missense probably benign 0.01
R1973:Olfr693 UTSW 7 106678219 missense probably benign 0.01
R2570:Olfr693 UTSW 7 106677667 missense probably benign 0.41
R3975:Olfr693 UTSW 7 106677785 missense probably damaging 1.00
R4840:Olfr693 UTSW 7 106678123 missense probably damaging 1.00
R5569:Olfr693 UTSW 7 106678483 start codon destroyed probably null 1.00
R6759:Olfr693 UTSW 7 106677893 missense probably benign
R7108:Olfr693 UTSW 7 106678048 missense probably benign 0.03
R7565:Olfr693 UTSW 7 106678126 missense probably damaging 1.00
R7800:Olfr693 UTSW 7 106677574 missense probably benign 0.03
X0025:Olfr693 UTSW 7 106678249 missense probably damaging 1.00
Z1088:Olfr693 UTSW 7 106678457 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GACTGTGAGAGGCCCATAGTAC -3'
(R):5'- TGGCCATTTGTCATCCATTGAAC -3'

Sequencing Primer
(F):5'- GTGAGAGGCCCATAGTACATCCC -3'
(R):5'- TTCATGAGGCCAAGCATCTG -3'
Posted On2018-09-12