Mutagenetix > Incidental Mutation

Incidental Mutation 'R6842:Trim66'

533908

Institutional Source

Beutler Lab

Gene Symbol

Trim66

Ensembl Gene

ENSMUSG00000031026

Gene Name

tripartite motif-containing 66

Synonyms

Tif1d, D7H11orf29

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R6842 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

109449006-109508134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109460776 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 801 (N801S)

Ref Sequence

ENSEMBL: ENSMUSP00000102352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]

AlphaFold

Q924W6

Predicted Effect

probably benign
Transcript: ENSMUST00000033339
AA Change: N699S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: N699S

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106739
AA Change: N699S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: N699S

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106741
AA Change: N801S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: N801S

Domain	Start	End	E-Value	Type
RING	28	78	2.38e-2	SMART
BBOX	102	140	1.48e0	SMART
PHD	106	171	7.77e0	SMART
RING	107	170	4.38e0	SMART
BBOX	162	203	4.21e-3	SMART
BBC	210	336	1.61e-39	SMART
low complexity region	420	435	N/A	INTRINSIC
low complexity region	554	588	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
low complexity region	670	683	N/A	INTRINSIC
PHD	1100	1143	4.09e-10	SMART
BROMO	1171	1277	8.22e-27	SMART
low complexity region	1287	1301	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	G	17: 56,877,432	N69S	probably benign	Het
9130011E15Rik	A	G	19: 45,818,977	V660A	probably benign	Het
Adgrl3	C	T	5: 81,741,080	A1042V	probably damaging	Het
Armc4	C	T	18: 7,268,401	D373N	probably benign	Het
C1s2	T	A	6: 124,627,502	H395L	probably benign	Het
Cacna1e	A	G	1: 154,483,117	I307T	probably damaging	Het
Cap2	T	C	13: 46,646,625	S381P	probably damaging	Het
Cbfa2t2	A	G	2: 154,524,045	T392A	probably benign	Het
Ccdc127	T	C	13: 74,356,969	I212T	probably damaging	Het
Cela3a	A	G	4: 137,405,668	V91A	probably benign	Het
Cep85	C	G	4: 134,155,856	A241P	probably benign	Het
Csmd2	T	C	4: 128,509,159	F2347L	possibly damaging	Het
Ddx19a	A	G	8: 110,978,625	V288A	possibly damaging	Het
Fbxl5	T	C	5: 43,773,586	E53G	probably damaging	Het
Fbxw26	A	T	9: 109,724,920	I217N	probably damaging	Het
Fgfr1op2	T	A	6: 146,590,038		probably null	Het
Ighv1-37	A	T	12: 114,896,655	I6N	probably damaging	Het
Klhdc10	T	C	6: 30,439,782	L128P	probably damaging	Het
Lypla1	C	T	1: 4,832,340	S24F	probably benign	Het
Mme	T	A	3: 63,362,044	D591E	probably damaging	Het
Mmp1b	T	A	9: 7,384,888	I254F	probably damaging	Het
Msr1	T	C	8: 39,632,825	M5V	probably benign	Het
Myh8	A	G	11: 67,284,655	D312G	probably damaging	Het
Nav2	T	C	7: 49,458,169	Y709H	possibly damaging	Het
Oas1g	T	C	5: 120,887,558	E2G	probably benign	Het
Ocm	T	A	5: 144,025,691	I6F	unknown	Het
Olfr160	T	C	9: 37,711,589	N230S	probably benign	Het
Olfr275	T	C	4: 52,825,576	Y60H	probably damaging	Het
Olfr693	T	C	7: 106,677,886	Y200C	probably damaging	Het
Olfr870	A	G	9: 20,171,253	L106P	possibly damaging	Het
Pax1	A	G	2: 147,373,720	D419G	probably benign	Het
Plbd1	T	A	6: 136,635,614	I194F	probably benign	Het
Prdx6	A	T	1: 161,247,370	C47S	probably damaging	Het
Sec24d	T	C	3: 123,343,219	S534P	probably benign	Het
Sgk3	T	C	1: 9,898,754	V452A	probably benign	Het
Sipa1l1	T	C	12: 82,420,546	V1177A	probably benign	Het
Tgfbr1	T	C	4: 47,383,757	C32R	probably damaging	Het
Utp6	C	T	11: 79,940,949	S504N	probably benign	Het
Wdsub1	A	C	2: 59,878,188	S114A	probably benign	Het
Wfikkn2	T	C	11: 94,238,040	E425G	probably damaging	Het
Zfp956	C	T	6: 47,963,829	T374I	possibly damaging	Het

Other mutations in Trim66

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01539:Trim66	APN	7	109455066	missense	probably benign	0.02
IGL01758:Trim66	APN	7	109486045	critical splice donor site	probably null
IGL01982:Trim66	APN	7	109458763	missense	probably benign	0.00
IGL01983:Trim66	APN	7	109458251	nonsense	probably null
IGL02149:Trim66	APN	7	109460902	missense	possibly damaging	0.66
IGL02392:Trim66	APN	7	109460274	missense	probably benign	0.01
IGL02483:Trim66	APN	7	109477630	splice site	probably benign
IGL02832:Trim66	APN	7	109460497	missense	probably damaging	1.00
IGL02945:Trim66	APN	7	109460176	nonsense	probably null
IGL03085:Trim66	APN	7	109458745	missense	probably benign	0.17
PIT1430001:Trim66	UTSW	7	109475247	missense	probably damaging	0.99
R0326:Trim66	UTSW	7	109460172	missense	probably benign	0.00
R0358:Trim66	UTSW	7	109460176	nonsense	probably null
R0401:Trim66	UTSW	7	109475264	missense	probably damaging	0.98
R0470:Trim66	UTSW	7	109457542	splice site	probably benign
R0568:Trim66	UTSW	7	109460695	missense	probably benign	0.00
R0669:Trim66	UTSW	7	109454992	intron	probably benign
R0980:Trim66	UTSW	7	109455670	missense	probably damaging	1.00
R1015:Trim66	UTSW	7	109455233	missense	probably damaging	1.00
R1078:Trim66	UTSW	7	109472319	missense	probably damaging	1.00
R1099:Trim66	UTSW	7	109475454	missense	probably benign	0.34
R1181:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R1497:Trim66	UTSW	7	109484619	missense	probably benign	0.00
R1583:Trim66	UTSW	7	109455080	missense	probably damaging	1.00
R1843:Trim66	UTSW	7	109475839	missense	probably damaging	0.99
R1998:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R2016:Trim66	UTSW	7	109472232	critical splice donor site	probably null
R2143:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2144:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2145:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R3945:Trim66	UTSW	7	109472268	missense	possibly damaging	0.94
R4012:Trim66	UTSW	7	109458131	missense	probably damaging	0.98
R4464:Trim66	UTSW	7	109477690	missense	possibly damaging	0.51
R4473:Trim66	UTSW	7	109481995	missense	probably damaging	1.00
R4729:Trim66	UTSW	7	109456060	critical splice donor site	probably null
R4730:Trim66	UTSW	7	109483069	missense	probably damaging	1.00
R4775:Trim66	UTSW	7	109457589	nonsense	probably null
R4819:Trim66	UTSW	7	109457586	missense	probably damaging	1.00
R5269:Trim66	UTSW	7	109457590	missense	probably benign	0.00
R5557:Trim66	UTSW	7	109483737	missense	probably benign	0.06
R5832:Trim66	UTSW	7	109455202	missense	probably damaging	1.00
R6220:Trim66	UTSW	7	109483093	missense	probably damaging	0.97
R6243:Trim66	UTSW	7	109460274	missense	probably benign	0.01
R6374:Trim66	UTSW	7	109486062	missense	probably benign
R6450:Trim66	UTSW	7	109460738	missense	probably benign	0.09
R6543:Trim66	UTSW	7	109475879	missense	probably benign	0.01
R6788:Trim66	UTSW	7	109477754	missense	probably damaging	1.00
R7169:Trim66	UTSW	7	109455121	missense	probably benign	0.25
R7257:Trim66	UTSW	7	109460244	missense	probably damaging	1.00
R7328:Trim66	UTSW	7	109457751	missense	probably damaging	0.99
R7616:Trim66	UTSW	7	109483749	missense	probably damaging	0.99
R8423:Trim66	UTSW	7	109475392	missense	possibly damaging	0.77
R8855:Trim66	UTSW	7	109481981	missense	probably damaging	1.00
R9130:Trim66	UTSW	7	109477689	missense	possibly damaging	0.90
R9137:Trim66	UTSW	7	109475123	missense	probably damaging	0.99
RF013:Trim66	UTSW	7	109460753	missense	probably damaging	0.99
RF024:Trim66	UTSW	7	109460740	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CATGCACATCAGAAACCGGTG -3'
(R):5'- ATGGGCTTTTCCAACACTGTG -3'

Sequencing Primer
(F):5'- TCAGAAACCGGTGGCATTC -3'
(R):5'- AGATGGAGTTGTCATCTACCAGGC -3'

Posted On

2018-09-12