Incidental Mutation 'R6842:Wfikkn2'
ID533917
Institutional Source Beutler Lab
Gene Symbol Wfikkn2
Ensembl Gene ENSMUSG00000044177
Gene NameWAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2
Synonyms2610304F08Rik, Gasp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6842 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location94235956-94246005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94238040 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 425 (E425G)
Ref Sequence ENSEMBL: ENSMUSP00000053238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061469]
Predicted Effect probably damaging
Transcript: ENSMUST00000061469
AA Change: E425G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053238
Gene: ENSMUSG00000044177
AA Change: E425G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
WAP 37 87 1.77e-3 SMART
low complexity region 91 102 N/A INTRINSIC
KAZAL 128 170 1.5e-2 SMART
low complexity region 179 192 N/A INTRINSIC
IGc2 217 289 1.3e-11 SMART
KU 321 374 2e-14 SMART
KU 379 432 2.79e-27 SMART
Pfam:NTR 451 556 2.1e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WFIKKN1 protein contains a WAP domain, follistatin domain, immunoglobulin domain, two tandem Kunitz domains, and an NTR domain. This gene encodes a WFIKKN1-related protein which has the same domain organization as the WFIKKN1 protein. The WAP-type, follistatin type, Kunitz-type, and NTR-type protease inhibitory domains may control the action of multiple types of proteases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show impaired muscle regeneration and a mild decrease in skeletal muscle weight in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,432 N69S probably benign Het
9130011E15Rik A G 19: 45,818,977 V660A probably benign Het
Adgrl3 C T 5: 81,741,080 A1042V probably damaging Het
Armc4 C T 18: 7,268,401 D373N probably benign Het
C1s2 T A 6: 124,627,502 H395L probably benign Het
Cacna1e A G 1: 154,483,117 I307T probably damaging Het
Cap2 T C 13: 46,646,625 S381P probably damaging Het
Cbfa2t2 A G 2: 154,524,045 T392A probably benign Het
Ccdc127 T C 13: 74,356,969 I212T probably damaging Het
Cela3a A G 4: 137,405,668 V91A probably benign Het
Cep85 C G 4: 134,155,856 A241P probably benign Het
Csmd2 T C 4: 128,509,159 F2347L possibly damaging Het
Ddx19a A G 8: 110,978,625 V288A possibly damaging Het
Fbxl5 T C 5: 43,773,586 E53G probably damaging Het
Fbxw26 A T 9: 109,724,920 I217N probably damaging Het
Fgfr1op2 T A 6: 146,590,038 probably null Het
Ighv1-37 A T 12: 114,896,655 I6N probably damaging Het
Klhdc10 T C 6: 30,439,782 L128P probably damaging Het
Lypla1 C T 1: 4,832,340 S24F probably benign Het
Mme T A 3: 63,362,044 D591E probably damaging Het
Mmp1b T A 9: 7,384,888 I254F probably damaging Het
Msr1 T C 8: 39,632,825 M5V probably benign Het
Myh8 A G 11: 67,284,655 D312G probably damaging Het
Nav2 T C 7: 49,458,169 Y709H possibly damaging Het
Oas1g T C 5: 120,887,558 E2G probably benign Het
Ocm T A 5: 144,025,691 I6F unknown Het
Olfr160 T C 9: 37,711,589 N230S probably benign Het
Olfr275 T C 4: 52,825,576 Y60H probably damaging Het
Olfr693 T C 7: 106,677,886 Y200C probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pax1 A G 2: 147,373,720 D419G probably benign Het
Plbd1 T A 6: 136,635,614 I194F probably benign Het
Prdx6 A T 1: 161,247,370 C47S probably damaging Het
Sec24d T C 3: 123,343,219 S534P probably benign Het
Sgk3 T C 1: 9,898,754 V452A probably benign Het
Sipa1l1 T C 12: 82,420,546 V1177A probably benign Het
Tgfbr1 T C 4: 47,383,757 C32R probably damaging Het
Trim66 T C 7: 109,460,776 N801S probably benign Het
Utp6 C T 11: 79,940,949 S504N probably benign Het
Wdsub1 A C 2: 59,878,188 S114A probably benign Het
Zfp956 C T 6: 47,963,829 T374I possibly damaging Het
Other mutations in Wfikkn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Wfikkn2 APN 11 94238095 nonsense probably null
R1269:Wfikkn2 UTSW 11 94238475 missense probably damaging 1.00
R1466:Wfikkn2 UTSW 11 94238895 missense probably damaging 1.00
R1466:Wfikkn2 UTSW 11 94238895 missense probably damaging 1.00
R1519:Wfikkn2 UTSW 11 94238107 missense probably benign 0.00
R1584:Wfikkn2 UTSW 11 94238895 missense probably damaging 1.00
R1856:Wfikkn2 UTSW 11 94238123 nonsense probably null
R2026:Wfikkn2 UTSW 11 94238953 missense possibly damaging 0.93
R2842:Wfikkn2 UTSW 11 94238259 missense probably benign 0.00
R4738:Wfikkn2 UTSW 11 94239076 missense probably benign 0.00
R4833:Wfikkn2 UTSW 11 94239052 missense probably benign 0.09
R5087:Wfikkn2 UTSW 11 94238347 missense probably damaging 1.00
R5775:Wfikkn2 UTSW 11 94238288 missense probably benign 0.22
R5966:Wfikkn2 UTSW 11 94238862 missense probably damaging 1.00
R7539:Wfikkn2 UTSW 11 94242359 missense probably damaging 1.00
R7544:Wfikkn2 UTSW 11 94237912 missense probably benign 0.09
R7849:Wfikkn2 UTSW 11 94238984 missense probably benign 0.01
R7879:Wfikkn2 UTSW 11 94238929 missense probably damaging 1.00
R8299:Wfikkn2 UTSW 11 94239064 missense probably damaging 1.00
Z1176:Wfikkn2 UTSW 11 94237652 missense possibly damaging 0.62
Z1176:Wfikkn2 UTSW 11 94238401 missense not run
Predicted Primers PCR Primer
(F):5'- CATCTTTTAAGACCTCATCCACGG -3'
(R):5'- TGGTCACTGCCACCACAATC -3'

Sequencing Primer
(F):5'- TCATCCACGGTCACCAGG -3'
(R):5'- TGAGACCTACGAGGCCTGTATG -3'
Posted On2018-09-12