Incidental Mutation 'R6813:Frmd3'
ID 533930
Institutional Source Beutler Lab
Gene Symbol Frmd3
Ensembl Gene ENSMUSG00000049122
Gene Name FERM domain containing 3
Synonyms 4.1O, EPB41L4O, P410, 9430066I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 74013442-74202214 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74159245 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 259 (S259P)
Ref Sequence ENSEMBL: ENSMUSP00000095615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084474] [ENSMUST00000098006]
AlphaFold Q8BHD4
Predicted Effect probably benign
Transcript: ENSMUST00000084474
AA Change: S259P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081514
Gene: ENSMUSG00000049122
AA Change: S259P

DomainStartEndE-ValueType
B41 28 225 5.17e-57 SMART
FERM_C 229 316 1.93e-18 SMART
FA 322 368 4.1e-13 SMART
low complexity region 391 401 N/A INTRINSIC
transmembrane domain 530 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098006
AA Change: S259P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095615
Gene: ENSMUSG00000049122
AA Change: S259P

DomainStartEndE-ValueType
B41 28 225 5.17e-57 SMART
FERM_C 229 316 1.93e-18 SMART
FA 322 368 4.1e-13 SMART
low complexity region 391 401 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single pass membrane protein primarily found in ovaries. A similar protein in erythrocytes helps determine the shape of red blood cells, but the function of the encoded protein has not been determined. There is some evidence that this is a tumor suppressor gene, and there is also evidence linking defects in this gene to susceptibility to diabetic nephropathy in type 1 diabetes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Frmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Frmd3 APN 4 74074120 missense possibly damaging 0.62
IGL01774:Frmd3 APN 4 74187838 missense probably damaging 1.00
IGL02213:Frmd3 APN 4 74135872 missense probably benign 0.36
IGL02479:Frmd3 APN 4 74187515 missense probably benign 0.30
IGL03248:Frmd3 APN 4 74128218 missense possibly damaging 0.71
R0765:Frmd3 UTSW 4 74161767 missense probably damaging 1.00
R1411:Frmd3 UTSW 4 74153621 missense probably damaging 1.00
R1535:Frmd3 UTSW 4 74013758 start gained probably benign
R1990:Frmd3 UTSW 4 74187439 missense probably damaging 1.00
R3898:Frmd3 UTSW 4 74074109 missense probably damaging 1.00
R4377:Frmd3 UTSW 4 74128298 critical splice donor site probably null
R4616:Frmd3 UTSW 4 74187872 missense probably benign 0.15
R4965:Frmd3 UTSW 4 74153600 missense probably damaging 1.00
R5024:Frmd3 UTSW 4 74098144 missense probably benign 0.00
R5104:Frmd3 UTSW 4 74145078 missense probably damaging 1.00
R5418:Frmd3 UTSW 4 74161698 critical splice acceptor site probably null
R5434:Frmd3 UTSW 4 74187796 missense probably damaging 1.00
R5878:Frmd3 UTSW 4 74153610 missense probably damaging 1.00
R5999:Frmd3 UTSW 4 74170691 missense possibly damaging 0.49
R6031:Frmd3 UTSW 4 74187451 missense probably damaging 0.99
R6031:Frmd3 UTSW 4 74187451 missense probably damaging 0.99
R6616:Frmd3 UTSW 4 74187488 missense probably damaging 0.97
R6941:Frmd3 UTSW 4 74098126 missense probably benign 0.20
R7233:Frmd3 UTSW 4 74013786 missense probably benign 0.09
R7334:Frmd3 UTSW 4 74161718 missense probably benign 0.02
R7429:Frmd3 UTSW 4 74145105 missense probably damaging 0.98
R7430:Frmd3 UTSW 4 74145105 missense probably damaging 0.98
R7979:Frmd3 UTSW 4 74153615 missense probably damaging 1.00
R8693:Frmd3 UTSW 4 74162049 missense probably damaging 0.97
R8994:Frmd3 UTSW 4 74170748 missense probably benign
R9065:Frmd3 UTSW 4 74145032 critical splice acceptor site probably null
R9351:Frmd3 UTSW 4 74135831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCCATTCTCAACAGACC -3'
(R):5'- TAGCTCTATCCAGTTAACATTGCTC -3'

Sequencing Primer
(F):5'- CCATTCTCAACAGACCATTATTGATG -3'
(R):5'- GGATTGCCATAAAAATTCTCTAGCTC -3'
Posted On 2018-09-12