Incidental Mutation 'R6813:Wdr78'
ID 533931
Institutional Source Beutler Lab
Gene Symbol Wdr78
Ensembl Gene ENSMUSG00000035126
Gene Name WD repeat domain 78
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 103038065-103114555 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103048326 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 753 (K753E)
Ref Sequence ENSEMBL: ENSMUSP00000102481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036451] [ENSMUST00000036557] [ENSMUST00000106868] [ENSMUST00000116316]
AlphaFold E9PYY5
Predicted Effect probably benign
Transcript: ENSMUST00000036451
SMART Domains Protein: ENSMUSP00000037588
Gene: ENSMUSG00000035126

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 2.11e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036557
SMART Domains Protein: ENSMUSP00000042272
Gene: ENSMUSG00000035126

DomainStartEndE-ValueType
low complexity region 59 67 N/A INTRINSIC
low complexity region 76 100 N/A INTRINSIC
WD40 133 172 9.24e-4 SMART
WD40 182 229 5.7e1 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 262 296 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106868
AA Change: K753E

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102481
Gene: ENSMUSG00000035126
AA Change: K753E

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 8.61e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
low complexity region 601 613 N/A INTRINSIC
Blast:WD40 614 648 3e-12 BLAST
WD40 652 692 2.38e-6 SMART
WD40 695 734 1.48e-2 SMART
WD40 739 779 6.14e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116316
SMART Domains Protein: ENSMUSP00000112018
Gene: ENSMUSG00000035126

DomainStartEndE-ValueType
low complexity region 12 20 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
low complexity region 138 157 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
low complexity region 382 390 N/A INTRINSIC
low complexity region 399 423 N/A INTRINSIC
internal_repeat_1 447 466 2.11e-5 PROSPERO
WD40 485 524 1.85e-3 SMART
WD40 534 581 5.7e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Wdr78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Wdr78 APN 4 103103242 missense possibly damaging 0.77
IGL01508:Wdr78 APN 4 103072687 missense possibly damaging 0.94
IGL01509:Wdr78 APN 4 103072687 missense possibly damaging 0.94
IGL01511:Wdr78 APN 4 103048361 missense possibly damaging 0.81
IGL01693:Wdr78 APN 4 103087330 splice site probably null
IGL01731:Wdr78 APN 4 103062435 missense probably benign 0.01
IGL02033:Wdr78 APN 4 103066293 missense possibly damaging 0.58
IGL02100:Wdr78 APN 4 103050149 missense probably damaging 1.00
IGL02218:Wdr78 APN 4 103096774 missense probably damaging 1.00
IGL02226:Wdr78 APN 4 103090398 missense probably benign 0.00
IGL02476:Wdr78 APN 4 103087348 missense possibly damaging 0.46
IGL02929:Wdr78 APN 4 103059991 nonsense probably null
R0070:Wdr78 UTSW 4 103059934 missense probably damaging 1.00
R0377:Wdr78 UTSW 4 103048259 missense probably damaging 1.00
R0433:Wdr78 UTSW 4 103103253 missense probably benign 0.41
R0518:Wdr78 UTSW 4 103064530 nonsense probably null
R0538:Wdr78 UTSW 4 103096618 missense possibly damaging 0.65
R0624:Wdr78 UTSW 4 103072857 splice site probably benign
R0894:Wdr78 UTSW 4 103049386 intron probably benign
R1463:Wdr78 UTSW 4 103087418 missense possibly damaging 0.95
R1818:Wdr78 UTSW 4 103072657 missense possibly damaging 0.67
R2073:Wdr78 UTSW 4 103050193 missense probably damaging 1.00
R2075:Wdr78 UTSW 4 103050193 missense probably damaging 1.00
R2436:Wdr78 UTSW 4 103066352 missense probably benign 0.01
R2851:Wdr78 UTSW 4 103096661 missense probably benign 0.12
R2852:Wdr78 UTSW 4 103096661 missense probably benign 0.12
R2853:Wdr78 UTSW 4 103050158 missense possibly damaging 0.90
R4491:Wdr78 UTSW 4 103066399 missense probably benign 0.04
R4792:Wdr78 UTSW 4 103072684 missense possibly damaging 0.94
R5223:Wdr78 UTSW 4 103049403 missense possibly damaging 0.87
R5290:Wdr78 UTSW 4 103049533 missense probably benign 0.00
R5465:Wdr78 UTSW 4 103049561 missense probably damaging 1.00
R5975:Wdr78 UTSW 4 103049589 missense probably benign 0.03
R6239:Wdr78 UTSW 4 103066443 missense probably benign
R6304:Wdr78 UTSW 4 103087356 missense probably benign 0.35
R6456:Wdr78 UTSW 4 103049549 missense probably benign 0.00
R6467:Wdr78 UTSW 4 103049561 missense probably damaging 1.00
R7161:Wdr78 UTSW 4 103096616 missense probably benign 0.28
R7198:Wdr78 UTSW 4 103062413 missense probably damaging 0.98
R7208:Wdr78 UTSW 4 103066352 missense probably benign 0.00
R7320:Wdr78 UTSW 4 103050187 missense possibly damaging 0.68
R7742:Wdr78 UTSW 4 103090433 missense probably benign
R7939:Wdr78 UTSW 4 103096601 nonsense probably null
R8120:Wdr78 UTSW 4 103066334 missense probably damaging 1.00
R8353:Wdr78 UTSW 4 103059916 missense possibly damaging 0.63
R8453:Wdr78 UTSW 4 103059916 missense possibly damaging 0.63
R8813:Wdr78 UTSW 4 103090500 missense possibly damaging 0.53
R8870:Wdr78 UTSW 4 103087332 critical splice donor site probably null
R8909:Wdr78 UTSW 4 103087410 missense possibly damaging 0.91
R8957:Wdr78 UTSW 4 103096753 missense probably damaging 1.00
R9035:Wdr78 UTSW 4 103048302 nonsense probably null
R9060:Wdr78 UTSW 4 103090553 missense probably benign 0.06
R9132:Wdr78 UTSW 4 103059733 missense probably damaging 1.00
R9141:Wdr78 UTSW 4 103049546 missense probably damaging 0.98
R9188:Wdr78 UTSW 4 103082135 missense
R9426:Wdr78 UTSW 4 103049546 missense probably damaging 0.98
Z1176:Wdr78 UTSW 4 103072771 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACACCTCATCTCCTCGAGGTAC -3'
(R):5'- TCTGAATTTGGAAAGACCCTAGGAG -3'

Sequencing Primer
(F):5'- TCATCTCCTCGAGGTACGGAAC -3'
(R):5'- AAGACAATGTTAGTGTGACA -3'
Posted On 2018-09-12