Incidental Mutation 'R6813:Tmem33'
ID533936
Institutional Source Beutler Lab
Gene Symbol Tmem33
Ensembl Gene ENSMUSG00000037720
Gene Nametransmembrane protein 33
Synonyms2700052H22Rik, 5430406L04Rik, 1110006G02Rik, 1600019D15Rik, 2410089A21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R6813 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location67260565-67291461 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 67264459 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037918] [ENSMUST00000160352] [ENSMUST00000161233] [ENSMUST00000161369] [ENSMUST00000162074] [ENSMUST00000162543] [ENSMUST00000201979]
Predicted Effect probably null
Transcript: ENSMUST00000037918
SMART Domains Protein: ENSMUSP00000042852
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 1 247 9.8e-126 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160352
SMART Domains Protein: ENSMUSP00000124766
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 1 246 2.8e-126 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161233
Predicted Effect probably null
Transcript: ENSMUST00000161369
SMART Domains Protein: ENSMUSP00000124390
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 7 245 1.8e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162074
Predicted Effect silent
Transcript: ENSMUST00000162543
SMART Domains Protein: ENSMUSP00000124765
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 1 119 2.1e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201979
SMART Domains Protein: ENSMUSP00000144531
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 7 61 5.9e-7 PFAM
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Tmem33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tmem33 APN 5 67284195 missense probably damaging 1.00
IGL02076:Tmem33 APN 5 67286103 missense probably damaging 1.00
IGL03106:Tmem33 APN 5 67263796 missense probably damaging 1.00
commonplace UTSW 5 67264459 critical splice donor site probably null
R0573:Tmem33 UTSW 5 67264260 intron probably benign
R0839:Tmem33 UTSW 5 67264308 missense probably damaging 1.00
R1129:Tmem33 UTSW 5 67264460 splice site probably null
R1438:Tmem33 UTSW 5 67267291 splice site probably null
R1692:Tmem33 UTSW 5 67268554 missense probably null 0.57
R4513:Tmem33 UTSW 5 67286125 missense probably benign 0.02
R4763:Tmem33 UTSW 5 67286136 missense probably benign 0.22
R6298:Tmem33 UTSW 5 67268551 nonsense probably null
R6673:Tmem33 UTSW 5 67286125 missense probably benign 0.02
R7186:Tmem33 UTSW 5 67263787 missense possibly damaging 0.68
R7378:Tmem33 UTSW 5 67286133 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCTCAGAATAACTTTTCCTCTGG -3'
(R):5'- CAGGTATAAACTTGTGCCTTGAATG -3'

Sequencing Primer
(F):5'- AACTTTTCCTCTGGTAATTTGCAGG -3'
(R):5'- ACTTGTGCCTTGAATGTTAACTG -3'
Posted On2018-09-12