Incidental Mutation 'R6813:Mgam'
ID 533940
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.184) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 40628831-40769123 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 40750165 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1257 (M1257L)
Ref Sequence ENSEMBL: ENSMUSP00000143946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071535
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201148
AA Change: M1257L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: M1257L

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202779
AA Change: M630L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: M630L

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 2 170 1.4e-53 PFAM
PD 297 350 1.4e-14 SMART
Pfam:NtCtMGAM_N 361 474 1.5e-26 PFAM
Blast:ANK 514 544 7e-8 BLAST
Pfam:Glyco_hydro_31 562 1064 2.2e-137 PFAM
low complexity region 1149 1164 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202966
AA Change: M511L

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: M511L

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Meta Mutation Damage Score 0.1816 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
BB002:Mgam UTSW 6 40759051 missense probably damaging 0.99
BB012:Mgam UTSW 6 40759051 missense probably damaging 0.99
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 splice site probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 splice site probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
R7525:Mgam UTSW 6 40766020 missense probably benign 0.01
R7530:Mgam UTSW 6 40709218 splice site probably null
R7570:Mgam UTSW 6 40746433 missense probably benign 0.16
R7669:Mgam UTSW 6 40659010 missense probably benign 0.00
R7679:Mgam UTSW 6 40643046 missense probably damaging 0.98
R7746:Mgam UTSW 6 40668193 missense probably damaging 0.99
R7859:Mgam UTSW 6 40740179 missense possibly damaging 0.75
R7925:Mgam UTSW 6 40759051 missense probably damaging 0.99
R8206:Mgam UTSW 6 40680235 missense probably benign 0.00
R8244:Mgam UTSW 6 40750586 missense probably damaging 1.00
R8309:Mgam UTSW 6 40745177 missense possibly damaging 0.88
R8472:Mgam UTSW 6 40694526 splice site probably null
R8758:Mgam UTSW 6 40729043 missense probably benign 0.41
R8777:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8783:Mgam UTSW 6 40656489 missense probably damaging 0.99
R8939:Mgam UTSW 6 40763203 critical splice donor site probably null
R8968:Mgam UTSW 6 40757811 critical splice acceptor site probably null
R8987:Mgam UTSW 6 40729636 missense probably damaging 1.00
R9055:Mgam UTSW 6 40714729 intron probably benign
R9171:Mgam UTSW 6 40768212 missense possibly damaging 0.76
R9252:Mgam UTSW 6 40729643 missense probably damaging 0.99
R9258:Mgam UTSW 6 40680187 missense probably benign
R9262:Mgam UTSW 6 40746488 critical splice donor site probably null
R9287:Mgam UTSW 6 40728971 intron probably benign
R9521:Mgam UTSW 6 40745184 missense probably damaging 1.00
R9589:Mgam UTSW 6 40750585 missense probably damaging 1.00
R9658:Mgam UTSW 6 40744377 missense possibly damaging 0.93
R9784:Mgam UTSW 6 40759090 missense probably damaging 1.00
RF011:Mgam UTSW 6 40757436 missense probably damaging 1.00
RF020:Mgam UTSW 6 40685309 missense probably damaging 1.00
RF023:Mgam UTSW 6 40680708 missense probably benign
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Z1176:Mgam UTSW 6 40677644 critical splice donor site probably null
Z1176:Mgam UTSW 6 40729066 missense probably damaging 1.00
Z1177:Mgam UTSW 6 40740071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTACATCATCAGCTTTCAAAG -3'
(R):5'- AAGGTGACCTCTGCACAGTTC -3'

Sequencing Primer
(F):5'- ATTTTGGGTGTTGTGTGAAGTCATG -3'
(R):5'- GCACAGTTCCATCCATTGTC -3'
Posted On 2018-09-12