Mutagenetix > Incidental Mutations

Incidental Mutation 'R6813:Mgam'

533940

Institutional Source

Beutler Lab

Gene Symbol

Mgam

Ensembl Gene

ENSMUSG00000068587

Gene Name

maltase-glucoamylase

Synonyms

6030407P20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R6813 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40628831-40769123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 40750165 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1257 (M1257L)

Ref Sequence

ENSEMBL: ENSMUSP00000143946 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000071535

SMART Domains

Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000201148
AA Change: M1257L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: M1257L

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202779
AA Change: M630L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: M630L

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	2	170	1.4e-53	PFAM
PD	297	350	1.4e-14	SMART
Pfam:NtCtMGAM_N	361	474	1.5e-26	PFAM
Blast:ANK	514	544	7e-8	BLAST
Pfam:Glyco_hydro_31	562	1064	2.2e-137	PFAM
low complexity region	1149	1164	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202966
AA Change: M511L

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: M511L

Domain	Start	End	E-Value	Type
internal_repeat_1	2	88	2.6e-19	PROSPERO
PD	178	231	1.4e-14	SMART
Pfam:NtCtMGAM_N	242	355	1.1e-26	PFAM
Blast:ANK	395	425	6e-8	BLAST
Pfam:Glyco_hydro_31	443	945	1.3e-137	PFAM

Meta Mutation Damage Score

0.1816

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 96.9%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,229,282	N2337K	probably benign	Het
Adgrb2	C	A	4: 130,009,491	Q603K	probably damaging	Het
Adgrf3	A	G	5: 30,197,521	F503S	probably damaging	Het
Arfgap3	A	T	15: 83,330,593	M164K	probably benign	Het
Asb13	G	T	13: 3,645,029	V166F	probably damaging	Het
Atm	T	G	9: 53,497,235	R1103S	probably benign	Het
Atxn7l1	T	C	12: 33,367,124	I626T	probably damaging	Het
Brsk2	A	G	7: 142,002,477	I649V	probably benign	Het
Ccdc25	T	A	14: 65,856,433	M85K	probably benign	Het
Cdc42bpb	A	G	12: 111,327,615	V231A	probably damaging	Het
Clstn3	T	A	6: 124,436,935	M767L	probably benign	Het
Col6a6	C	T	9: 105,783,941	R323K	probably benign	Het
Creld1	A	G	6: 113,489,569	Y199C	probably damaging	Het
Csf1r	T	A	18: 61,112,734	D254E	probably benign	Het
Dab2ip	C	T	2: 35,730,473	Q1118*	probably null	Het
Dcun1d4	C	A	5: 73,520,957	S98R	possibly damaging	Het
Disp3	G	A	4: 148,259,930	P505L	probably benign	Het
Dlec1	A	T	9: 119,112,102	Q240L	probably benign	Het
Edil3	T	A	13: 89,289,456	I392N	probably damaging	Het
Epha10	T	A	4: 124,902,693	S398R		Het
Ephb1	A	G	9: 102,010,048	I464T	possibly damaging	Het
Eps15	T	A	4: 109,280,402		probably null	Het
Fam111a	T	A	19: 12,587,342	C152S	probably damaging	Het
Flt3	T	C	5: 147,354,843	E599G	probably damaging	Het
Frmd3	T	C	4: 74,159,245	S259P	probably benign	Het
Gm15922	T	C	7: 3,736,003	H535R	probably benign	Het
Gm30302	T	A	13: 49,787,396	R279S	probably benign	Het
Hsfy2	A	G	1: 56,636,302	Y359H	possibly damaging	Het
Ifih1	C	T	2: 62,645,693	V80M	possibly damaging	Het
Il12rb2	A	C	6: 67,292,374	D818E	probably damaging	Het
Il4i1	A	G	7: 44,839,812	T334A	probably benign	Het
Irs2	G	A	8: 11,004,659	Q1258*	probably null	Het
Lsm1	T	G	8: 25,793,693	H44Q	probably benign	Het
Myc	T	C	15: 61,988,152	S225P	probably damaging	Het
Myh1	T	C	11: 67,220,460	V1575A	probably benign	Het
Myo9b	A	G	8: 71,323,305	D380G	probably damaging	Het
Ncoa7	T	A	10: 30,696,192	D157V	probably damaging	Het
Olfr314	G	T	11: 58,786,646	Q137H	probably benign	Het
Olfr828	G	A	9: 18,815,892	T134M	probably benign	Het
Olfr877	A	C	9: 37,855,514	E232A	possibly damaging	Het
Olfr883	T	C	9: 38,025,833	V9A	probably damaging	Het
Olfr980	T	A	9: 40,006,457	H164L	probably benign	Het
Pccb	A	G	9: 101,023,215	V117A	probably damaging	Het
Pdp2	C	T	8: 104,594,499	H327Y	probably damaging	Het
Pdzph1	G	T	17: 58,974,436	Q284K	probably benign	Het
Phka2	G	A	X: 160,533,048	V230I	probably damaging	Het
Phldb1	A	T	9: 44,699,568	S751R	probably damaging	Het
Ppp1r1b	T	A	11: 98,349,176		probably null	Het
Ppp1r3a	A	G	6: 14,719,571	V448A	probably benign	Het
Pvrig	A	T	5: 138,342,050	T28S	probably benign	Het
Rasgrf1	G	A	9: 90,010,484		probably null	Het
Scnn1g	T	C	7: 121,740,353	L125S	probably damaging	Het
Slc30a7	A	T	3: 115,981,811	D221E	probably benign	Het
Tmem30c	A	G	16: 57,281,259		probably null	Het
Tmem33	T	C	5: 67,264,459		probably null	Het
Ttc29	A	T	8: 78,333,620	T390S	probably benign	Het
Vamp5	G	A	6: 72,380,441		probably benign	Het
Vmn2r81	T	A	10: 79,268,605	F354Y	probably benign	Het
Vmn2r96	A	G	17: 18,581,854	H119R	probably benign	Het
Wdr3	G	A	3: 100,138,725	R931*	probably null	Het
Wdr78	T	C	4: 103,048,326	K753E	probably benign	Het
Wtap	A	T	17: 12,967,510	N383K	probably damaging	Het
Zfp808	T	C	13: 62,173,035	Y693H	probably damaging	Het

Other mutations in Mgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Mgam	APN	6	40643010	missense	probably benign
IGL01065:Mgam	APN	6	40662710	critical splice donor site	probably null
IGL01402:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01404:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01413:Mgam	APN	6	40661277	missense	probably damaging	1.00
IGL01546:Mgam	APN	6	40654693	missense	probably damaging	0.98
IGL01596:Mgam	APN	6	40658270	missense	probably damaging	1.00
IGL02133:Mgam	APN	6	40643076	missense	probably damaging	0.98
IGL02734:Mgam	APN	6	40662694	missense	probably damaging	1.00
BB002:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
BB012:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R0012:Mgam	UTSW	6	40765256	splice site	probably null
R0116:Mgam	UTSW	6	40658987	missense	probably damaging	1.00
R0310:Mgam	UTSW	6	40761035	splice site	probably benign
R0452:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
R0497:Mgam	UTSW	6	40664892	missense	probably damaging	1.00
R0699:Mgam	UTSW	6	40643019	missense	possibly damaging	0.84
R0738:Mgam	UTSW	6	40754935	missense	probably benign	0.01
R1033:Mgam	UTSW	6	40680624	missense	probably benign	0.07
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1430:Mgam	UTSW	6	40756371	missense	probably benign	0.08
R1432:Mgam	UTSW	6	40756367	missense	probably damaging	1.00
R1443:Mgam	UTSW	6	40759780	nonsense	probably null
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1519:Mgam	UTSW	6	40661683	missense	probably benign	0.45
R1654:Mgam	UTSW	6	40757487	missense	probably damaging	1.00
R1667:Mgam	UTSW	6	40677044	missense	possibly damaging	0.62
R1730:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1781:Mgam	UTSW	6	40669863	missense	probably damaging	1.00
R1783:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1829:Mgam	UTSW	6	40666892	missense	probably damaging	1.00
R1833:Mgam	UTSW	6	40654718	critical splice donor site	probably null
R1872:Mgam	UTSW	6	40661300	nonsense	probably null
R1912:Mgam	UTSW	6	40764185	nonsense	probably null
R1977:Mgam	UTSW	6	40664880	missense	probably benign	0.01
R2048:Mgam	UTSW	6	40656429	missense	possibly damaging	0.80
R2086:Mgam	UTSW	6	40761028	splice site	probably null
R2138:Mgam	UTSW	6	40756450	missense	probably damaging	1.00
R2224:Mgam	UTSW	6	40764274	splice site	probably null
R2408:Mgam	UTSW	6	40686522	missense	probably damaging	1.00
R2508:Mgam	UTSW	6	40759783	missense	probably damaging	1.00
R2842:Mgam	UTSW	6	40661345	missense	probably benign	0.01
R2847:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2848:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2965:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R2966:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R3035:Mgam	UTSW	6	40663530	missense	probably benign
R3895:Mgam	UTSW	6	40759120	missense	probably damaging	1.00
R4027:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4030:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4302:Mgam	UTSW	6	40763085	missense	probably benign	0.02
R4707:Mgam	UTSW	6	40714632	splice site	probably null
R4826:Mgam	UTSW	6	40680648	missense	possibly damaging	0.52
R4898:Mgam	UTSW	6	40643054	missense	probably benign
R5438:Mgam	UTSW	6	40684521	missense	probably damaging	1.00
R5492:Mgam	UTSW	6	40756363	missense	probably damaging	1.00
R5770:Mgam	UTSW	6	40669804	missense	probably benign	0.01
R5839:Mgam	UTSW	6	40740064	missense	possibly damaging	0.90
R5845:Mgam	UTSW	6	40675323	missense	possibly damaging	0.78
R5847:Mgam	UTSW	6	40684055	missense	probably benign	0.42
R5891:Mgam	UTSW	6	40744348	missense	probably benign
R6158:Mgam	UTSW	6	40757714	missense	probably damaging	1.00
R6193:Mgam	UTSW	6	40747920	nonsense	probably null
R6423:Mgam	UTSW	6	40677045	missense	possibly damaging	0.84
R6706:Mgam	UTSW	6	40744786	missense	probably benign	0.00
R6863:Mgam	UTSW	6	40729009	missense	probably benign	0.00
R6906:Mgam	UTSW	6	40747919	missense	probably damaging	1.00
R7091:Mgam	UTSW	6	40768276	missense	possibly damaging	0.95
R7099:Mgam	UTSW	6	40661716	missense	probably benign	0.09
R7282:Mgam	UTSW	6	40656512	missense	possibly damaging	0.71
R7282:Mgam	UTSW	6	40763111	missense	probably benign
R7354:Mgam	UTSW	6	40744798	missense	probably damaging	1.00
R7374:Mgam	UTSW	6	40757439	missense	possibly damaging	0.89
R7399:Mgam	UTSW	6	40666854	missense	probably damaging	0.99
R7406:Mgam	UTSW	6	40663525	missense	probably benign	0.13
R7446:Mgam	UTSW	6	40746332	missense	probably damaging	1.00
R7466:Mgam	UTSW	6	40744789	missense	probably benign	0.00
R7525:Mgam	UTSW	6	40766020	missense	probably benign	0.01
R7530:Mgam	UTSW	6	40709218	splice site	probably null
R7570:Mgam	UTSW	6	40746433	missense	probably benign	0.16
R7669:Mgam	UTSW	6	40659010	missense	probably benign	0.00
R7679:Mgam	UTSW	6	40643046	missense	probably damaging	0.98
R7746:Mgam	UTSW	6	40668193	missense	probably damaging	0.99
R7859:Mgam	UTSW	6	40740179	missense	possibly damaging	0.75
R7925:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R8206:Mgam	UTSW	6	40680235	missense	probably benign	0.00
R8244:Mgam	UTSW	6	40750586	missense	probably damaging	1.00
R8309:Mgam	UTSW	6	40745177	missense	possibly damaging	0.88
R8472:Mgam	UTSW	6	40694526	splice site	probably null
R8758:Mgam	UTSW	6	40729043	missense	probably benign	0.41
R8777:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8777-TAIL:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8783:Mgam	UTSW	6	40656489	missense	probably damaging	0.99
R8939:Mgam	UTSW	6	40763203	critical splice donor site	probably null
R8968:Mgam	UTSW	6	40757811	critical splice acceptor site	probably null
R8987:Mgam	UTSW	6	40729636	missense	probably damaging	1.00
R9171:Mgam	UTSW	6	40768212	missense	possibly damaging	0.76
R9252:Mgam	UTSW	6	40729643	missense	probably damaging	0.99
R9258:Mgam	UTSW	6	40680187	missense	probably benign
R9262:Mgam	UTSW	6	40746488	critical splice donor site	probably null
R9287:Mgam	UTSW	6	40728971	intron	probably benign
RF011:Mgam	UTSW	6	40757436	missense	probably damaging	1.00
RF020:Mgam	UTSW	6	40685309	missense	probably damaging	1.00
RF023:Mgam	UTSW	6	40680708	missense	probably benign
X0021:Mgam	UTSW	6	40659047	missense	probably damaging	1.00
Z1088:Mgam	UTSW	6	40643060	missense	probably benign	0.01
Z1176:Mgam	UTSW	6	40677644	critical splice donor site	probably null
Z1176:Mgam	UTSW	6	40729066	missense	probably damaging	1.00
Z1177:Mgam	UTSW	6	40740071	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCCTACATCATCAGCTTTCAAAG -3'
(R):5'- AAGGTGACCTCTGCACAGTTC -3'

Sequencing Primer
(F):5'- ATTTTGGGTGTTGTGTGAAGTCATG -3'
(R):5'- GCACAGTTCCATCCATTGTC -3'

Posted On

2018-09-12