Incidental Mutation 'R6813:Brsk2'
ID533948
Institutional Source Beutler Lab
Gene Symbol Brsk2
Ensembl Gene ENSMUSG00000053046
Gene NameBR serine/threonine kinase 2
Synonyms4833424K13Rik, SAD-A
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6813 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141949751-142004247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142002477 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 649 (I649V)
Ref Sequence ENSEMBL: ENSMUSP00000018971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018971] [ENSMUST00000075528] [ENSMUST00000078200] [ENSMUST00000105989] [ENSMUST00000172652] [ENSMUST00000173705] [ENSMUST00000174237] [ENSMUST00000174309] [ENSMUST00000174405] [ENSMUST00000174499]
Predicted Effect probably benign
Transcript: ENSMUST00000018971
AA Change: I649V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000018971
Gene: ENSMUSG00000053046
AA Change: I649V

DomainStartEndE-ValueType
S_TKc 20 271 3.65e-99 SMART
low complexity region 410 429 N/A INTRINSIC
low complexity region 456 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075528
SMART Domains Protein: ENSMUSP00000074969
Gene: ENSMUSG00000053046

DomainStartEndE-ValueType
S_TKc 20 271 3.65e-99 SMART
low complexity region 410 429 N/A INTRINSIC
low complexity region 456 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078200
SMART Domains Protein: ENSMUSP00000077330
Gene: ENSMUSG00000053046

DomainStartEndE-ValueType
S_TKc 20 271 3.65e-99 SMART
low complexity region 410 429 N/A INTRINSIC
low complexity region 456 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105989
SMART Domains Protein: ENSMUSP00000101610
Gene: ENSMUSG00000053046

DomainStartEndE-ValueType
S_TKc 20 271 3.65e-99 SMART
low complexity region 410 429 N/A INTRINSIC
low complexity region 456 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172652
SMART Domains Protein: ENSMUSP00000133438
Gene: ENSMUSG00000053046

DomainStartEndE-ValueType
S_TKc 20 271 3.65e-99 SMART
low complexity region 432 451 N/A INTRINSIC
low complexity region 478 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172967
SMART Domains Protein: ENSMUSP00000133750
Gene: ENSMUSG00000053046

DomainStartEndE-ValueType
S_TKc 3 240 6.78e-85 SMART
low complexity region 379 398 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173313
SMART Domains Protein: ENSMUSP00000133868
Gene: ENSMUSG00000053046

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Blast:S_TKc 14 61 3e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173705
SMART Domains Protein: ENSMUSP00000134170
Gene: ENSMUSG00000053046

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 111 4.4e-10 PFAM
Pfam:Pkinase 1 113 2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173924
SMART Domains Protein: ENSMUSP00000134153
Gene: ENSMUSG00000053046

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 98 3.7e-13 PFAM
Pfam:Pkinase 1 209 2.6e-29 PFAM
low complexity region 239 258 N/A INTRINSIC
low complexity region 285 304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173941
Predicted Effect probably benign
Transcript: ENSMUST00000174237
SMART Domains Protein: ENSMUSP00000134566
Gene: ENSMUSG00000053046

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Blast:S_TKc 32 79 6e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174309
SMART Domains Protein: ENSMUSP00000134310
Gene: ENSMUSG00000053046

DomainStartEndE-ValueType
Pfam:Pkinase 1 82 7.1e-13 PFAM
low complexity region 221 240 N/A INTRINSIC
low complexity region 267 286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174405
SMART Domains Protein: ENSMUSP00000134289
Gene: ENSMUSG00000053046

DomainStartEndE-ValueType
Pfam:Pkinase 20 92 1e-13 PFAM
Pfam:Pkinase_Tyr 20 92 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174499
SMART Domains Protein: ENSMUSP00000134201
Gene: ENSMUSG00000053046

DomainStartEndE-ValueType
S_TKc 20 271 3.65e-99 SMART
low complexity region 410 429 N/A INTRINSIC
low complexity region 456 475 N/A INTRINSIC
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Homozygous mutant mice are healthy and fertile. Mice homozygous for a condition allele activated in sensory and motor neurons exhibit partial neonatal lethality, hypokinesis, absnece of gastric milk and abnormal type Ia proprioceptive sensory neuron projections [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Brsk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Brsk2 APN 7 141981555 missense possibly damaging 0.53
IGL02243:Brsk2 APN 7 141993299 missense probably damaging 1.00
R0400:Brsk2 UTSW 7 141998553 missense probably damaging 1.00
R0609:Brsk2 UTSW 7 141998492 missense probably damaging 0.99
R0972:Brsk2 UTSW 7 141993704 splice site probably benign
R1699:Brsk2 UTSW 7 141985463 missense probably damaging 0.97
R3928:Brsk2 UTSW 7 141998418 missense probably damaging 1.00
R5357:Brsk2 UTSW 7 141984511 missense possibly damaging 0.55
R5411:Brsk2 UTSW 7 142000857 missense probably benign 0.03
R5461:Brsk2 UTSW 7 141987906 missense probably damaging 1.00
R6966:Brsk2 UTSW 7 141984533 missense possibly damaging 0.48
R7560:Brsk2 UTSW 7 142000860 missense probably benign 0.00
R7810:Brsk2 UTSW 7 141985420 splice site probably null
R7922:Brsk2 UTSW 7 141993220 missense possibly damaging 0.63
R8254:Brsk2 UTSW 7 141984416 missense probably damaging 1.00
R8336:Brsk2 UTSW 7 141984474 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCCTTAGACACTAGTCCC -3'
(R):5'- TGAGGATCTGGTCACTGGGATC -3'

Sequencing Primer
(F):5'- ACACAGCACTGACTGTGG -3'
(R):5'- AAGAGGAACCCCTGGGC -3'
Posted On2018-09-12