Incidental Mutation 'R6813:Olfr980'
ID 533957
Institutional Source Beutler Lab
Gene Symbol Olfr980
Ensembl Gene ENSMUSG00000060254
Gene Name olfactory receptor 980
Synonyms MOR223-2, GA_x6K02T2PVTD-33705428-33704496
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 40004348-40009582 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40006457 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 164 (H164L)
Ref Sequence ENSEMBL: ENSMUSP00000150496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073932] [ENSMUST00000215523] [ENSMUST00000216463]
AlphaFold Q8VH08
Predicted Effect probably benign
Transcript: ENSMUST00000073932
AA Change: H164L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091386
Gene: ENSMUSG00000060254
AA Change: H164L

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.4e-55 PFAM
Pfam:7tm_1 39 287 5.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215523
Predicted Effect probably benign
Transcript: ENSMUST00000216463
AA Change: H164L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.2575 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Olfr980
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02256:Olfr980 APN 9 40006053 missense probably benign
IGL02378:Olfr980 APN 9 40006473 missense probably damaging 1.00
IGL03384:Olfr980 APN 9 40006470 missense probably benign
IGL03402:Olfr980 APN 9 40006506 missense probably benign 0.31
BB010:Olfr980 UTSW 9 40007135 start gained probably benign
PIT4651001:Olfr980 UTSW 9 40006230 missense probably damaging 0.97
R0013:Olfr980 UTSW 9 40006355 missense probably damaging 1.00
R1146:Olfr980 UTSW 9 40006094 missense possibly damaging 0.95
R1146:Olfr980 UTSW 9 40006094 missense possibly damaging 0.95
R4541:Olfr980 UTSW 9 40006293 missense possibly damaging 0.95
R4562:Olfr980 UTSW 9 40006281 missense probably damaging 0.99
R4731:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4732:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4733:Olfr980 UTSW 9 40006268 missense probably damaging 1.00
R4825:Olfr980 UTSW 9 40006742 missense possibly damaging 0.72
R5619:Olfr980 UTSW 9 40006743 missense probably benign 0.07
R5770:Olfr980 UTSW 9 40006338 missense probably benign 0.01
R5791:Olfr980 UTSW 9 40006734 missense probably damaging 1.00
R6819:Olfr980 UTSW 9 40006548 missense probably benign 0.00
R6970:Olfr980 UTSW 9 40006713 missense probably benign 0.00
R7490:Olfr980 UTSW 9 40006424 missense probably damaging 1.00
R7511:Olfr980 UTSW 9 40006933 missense possibly damaging 0.63
R7933:Olfr980 UTSW 9 40007135 start gained probably benign
R8243:Olfr980 UTSW 9 40006188 missense probably benign 0.19
Z1088:Olfr980 UTSW 9 40006596 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAGTGCGAATCCTCAGGATG -3'
(R):5'- TGGCACAGCTCTATTGCTTC -3'

Sequencing Primer
(F):5'- TCCTCAGGATGGAGCAGAC -3'
(R):5'- CACTTCCTGGGTAGCACCGAG -3'
Posted On 2018-09-12