Incidental Mutation 'R6813:Phldb1'
ID 533958
Institutional Source Beutler Lab
Gene Symbol Phldb1
Ensembl Gene ENSMUSG00000048537
Gene Name pleckstrin homology like domain, family B, member 1
Synonyms LL5A, D330037A14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 44686304-44735198 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 44699568 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 751 (S751R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034611] [ENSMUST00000123310] [ENSMUST00000134465] [ENSMUST00000135436] [ENSMUST00000138356] [ENSMUST00000144251] [ENSMUST00000147495] [ENSMUST00000154723] [ENSMUST00000156918]
AlphaFold Q6PDH0
Predicted Effect possibly damaging
Transcript: ENSMUST00000034611
AA Change: S1007R

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034611
Gene: ENSMUSG00000048537
AA Change: S1007R

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5.01e-5 PROSPERO
internal_repeat_1 401 449 5.01e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1366 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123123
Predicted Effect probably benign
Transcript: ENSMUST00000123310
AA Change: S89R

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122374
Gene: ENSMUSG00000048537
AA Change: S89R

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 185 193 N/A INTRINSIC
coiled coil region 232 259 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000128326
AA Change: S452R

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119966
Gene: ENSMUSG00000048537
AA Change: S452R

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
coiled coil region 357 396 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 493 506 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 564 572 N/A INTRINSIC
coiled coil region 610 679 N/A INTRINSIC
PH 723 827 1.31e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000134465
AA Change: S960R

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117395
Gene: ENSMUSG00000048537
AA Change: S960R

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 8e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 6.75e-5 PROSPERO
internal_repeat_1 401 449 6.75e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 929 950 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
coiled coil region 1103 1172 N/A INTRINSIC
PH 1215 1319 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135436
AA Change: S131R

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120023
Gene: ENSMUSG00000048537
AA Change: S131R

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
coiled coil region 274 343 N/A INTRINSIC
PH 386 490 1.31e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138356
AA Change: S1063R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120208
Gene: ENSMUSG00000048537
AA Change: S1063R

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 4.93e-5 PROSPERO
internal_repeat_1 401 449 4.93e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 931 948 N/A INTRINSIC
low complexity region 999 1017 N/A INTRINSIC
low complexity region 1032 1053 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
low complexity region 1159 1167 N/A INTRINSIC
coiled coil region 1206 1286 N/A INTRINSIC
PH 1329 1444 6.01e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144251
AA Change: S320R

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114773
Gene: ENSMUSG00000048537
AA Change: S320R

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
coiled coil region 146 174 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
coiled coil region 225 264 N/A INTRINSIC
low complexity region 289 310 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
low complexity region 416 424 N/A INTRINSIC
coiled coil region 463 532 N/A INTRINSIC
PH 575 679 1.31e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147495
AA Change: S1007R

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122661
Gene: ENSMUSG00000048537
AA Change: S1007R

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5e-5 PROSPERO
internal_repeat_1 401 449 5e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1377 6.01e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148344
AA Change: S751R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121809
Gene: ENSMUSG00000048537
AA Change: S751R

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 41 61 N/A INTRINSIC
internal_repeat_1 66 99 6.7e-6 PROSPERO
internal_repeat_1 146 194 6.7e-6 PROSPERO
low complexity region 204 222 N/A INTRINSIC
low complexity region 335 362 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
coiled coil region 459 542 N/A INTRINSIC
low complexity region 564 574 N/A INTRINSIC
coiled coil region 609 648 N/A INTRINSIC
low complexity region 688 706 N/A INTRINSIC
low complexity region 721 742 N/A INTRINSIC
low complexity region 792 805 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 863 871 N/A INTRINSIC
coiled coil region 909 978 N/A INTRINSIC
PH 1022 1126 1.31e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000154723
AA Change: S260R
SMART Domains Protein: ENSMUSP00000116987
Gene: ENSMUSG00000048537
AA Change: S260R

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
coiled coil region 118 157 N/A INTRINSIC
low complexity region 197 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156918
AA Change: S277R

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120092
Gene: ENSMUSG00000048537
AA Change: S277R

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
low complexity region 136 146 N/A INTRINSIC
coiled coil region 182 221 N/A INTRINSIC
low complexity region 246 267 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
low complexity region 373 381 N/A INTRINSIC
coiled coil region 420 489 N/A INTRINSIC
PH 532 636 1.31e-17 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Phldb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Phldb1 APN 9 44711146 critical splice donor site probably null
IGL01089:Phldb1 APN 9 44707887 nonsense probably null
IGL01374:Phldb1 APN 9 44696167 missense probably damaging 0.98
IGL01654:Phldb1 APN 9 44718357 splice site probably null
IGL02148:Phldb1 APN 9 44696072 missense probably damaging 0.99
IGL02408:Phldb1 APN 9 44715906 missense possibly damaging 0.50
IGL02429:Phldb1 APN 9 44700950 missense probably damaging 1.00
IGL02440:Phldb1 APN 9 44715403 missense probably damaging 0.99
IGL02457:Phldb1 APN 9 44716474 missense probably benign 0.00
IGL02471:Phldb1 APN 9 44711233 missense probably damaging 1.00
IGL02506:Phldb1 APN 9 44710926 missense probably benign 0.00
IGL03335:Phldb1 APN 9 44728069 missense possibly damaging 0.95
PIT4515001:Phldb1 UTSW 9 44715960 missense probably benign 0.00
R0070:Phldb1 UTSW 9 44707904 missense probably damaging 1.00
R0117:Phldb1 UTSW 9 44711706 start codon destroyed probably null
R0344:Phldb1 UTSW 9 44701667 missense probably benign 0.14
R0364:Phldb1 UTSW 9 44699335 splice site probably benign
R0622:Phldb1 UTSW 9 44715852 missense probably damaging 1.00
R0737:Phldb1 UTSW 9 44699636 missense possibly damaging 0.92
R1449:Phldb1 UTSW 9 44716633 missense probably benign 0.17
R1498:Phldb1 UTSW 9 44701618 missense possibly damaging 0.70
R1633:Phldb1 UTSW 9 44718322 missense probably damaging 1.00
R1647:Phldb1 UTSW 9 44715433 missense probably damaging 1.00
R1692:Phldb1 UTSW 9 44715420 missense probably damaging 1.00
R1749:Phldb1 UTSW 9 44715748 missense probably damaging 1.00
R1797:Phldb1 UTSW 9 44716545 missense probably damaging 0.99
R2012:Phldb1 UTSW 9 44728036 missense possibly damaging 0.67
R2078:Phldb1 UTSW 9 44707979 missense probably damaging 1.00
R2208:Phldb1 UTSW 9 44696131 missense probably damaging 1.00
R2567:Phldb1 UTSW 9 44726025 missense probably damaging 0.99
R2696:Phldb1 UTSW 9 44718288 missense probably damaging 1.00
R3705:Phldb1 UTSW 9 44694394 missense probably damaging 0.97
R4110:Phldb1 UTSW 9 44715831 missense possibly damaging 0.88
R4772:Phldb1 UTSW 9 44711027 missense probably damaging 1.00
R4857:Phldb1 UTSW 9 44696092 missense probably damaging 0.99
R5148:Phldb1 UTSW 9 44704158 missense probably benign 0.04
R5651:Phldb1 UTSW 9 44711903 missense probably damaging 1.00
R5666:Phldb1 UTSW 9 44715781 missense probably damaging 0.97
R5670:Phldb1 UTSW 9 44715781 missense probably damaging 0.97
R5914:Phldb1 UTSW 9 44711651 missense probably damaging 0.97
R6232:Phldb1 UTSW 9 44696117 missense probably damaging 1.00
R6257:Phldb1 UTSW 9 44696140 missense probably damaging 0.99
R6413:Phldb1 UTSW 9 44696143 missense probably damaging 1.00
R6418:Phldb1 UTSW 9 44711900 missense probably damaging 1.00
R6845:Phldb1 UTSW 9 44716062 missense probably damaging 1.00
R7009:Phldb1 UTSW 9 44694408 missense probably damaging 1.00
R7042:Phldb1 UTSW 9 44694424 missense probably damaging 1.00
R7062:Phldb1 UTSW 9 44696135 missense probably damaging 0.99
R7077:Phldb1 UTSW 9 44711904 missense possibly damaging 0.62
R7307:Phldb1 UTSW 9 44694047 missense possibly damaging 0.62
R7995:Phldb1 UTSW 9 44715372 missense probably damaging 1.00
R8108:Phldb1 UTSW 9 44711161 missense probably damaging 1.00
R8433:Phldb1 UTSW 9 44716462 missense probably damaging 1.00
R9151:Phldb1 UTSW 9 44708443 missense probably null 0.01
R9366:Phldb1 UTSW 9 44711249 missense possibly damaging 0.93
R9378:Phldb1 UTSW 9 44704128 missense probably benign 0.01
RF020:Phldb1 UTSW 9 44697946 missense probably damaging 1.00
X0020:Phldb1 UTSW 9 44687677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATGTCCTGCAGTGTGG -3'
(R):5'- TTGGATCACAGCTGGGTTAG -3'

Sequencing Primer
(F):5'- CAGTGTGGCTGCCAGGTTG -3'
(R):5'- TGTGACATGGCAGCCAGTG -3'
Posted On 2018-09-12