Incidental Mutation 'R6813:Atm'
ID 533959
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Name ataxia telangiectasia mutated
Synonyms C030026E19Rik
MMRRC Submission 044925-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.923) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 53350449-53448040 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 53408535 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 1103 (R1103S)
Ref Sequence ENSEMBL: ENSMUSP00000113388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000118282
AA Change: R1103S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: R1103S

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232179
AA Change: R1103S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 C A 4: 129,903,284 (GRCm39) Q603K probably damaging Het
Adgrf3 A G 5: 30,402,519 (GRCm39) F503S probably damaging Het
Arfgap3 A T 15: 83,214,794 (GRCm39) M164K probably benign Het
Asb13 G T 13: 3,695,029 (GRCm39) V166F probably damaging Het
Atxn7l1 T C 12: 33,417,123 (GRCm39) I626T probably damaging Het
Brsk2 A G 7: 141,556,214 (GRCm39) I649V probably benign Het
Ccdc25 T A 14: 66,093,882 (GRCm39) M85K probably benign Het
Cdc42bpb A G 12: 111,294,049 (GRCm39) V231A probably damaging Het
Clstn3 T A 6: 124,413,894 (GRCm39) M767L probably benign Het
Col6a6 C T 9: 105,661,140 (GRCm39) R323K probably benign Het
Cplane1 T A 15: 8,258,766 (GRCm39) N2337K probably benign Het
Creld1 A G 6: 113,466,530 (GRCm39) Y199C probably damaging Het
Csf1r T A 18: 61,245,806 (GRCm39) D254E probably benign Het
Dab2ip C T 2: 35,620,485 (GRCm39) Q1118* probably null Het
Dcun1d4 C A 5: 73,678,300 (GRCm39) S98R possibly damaging Het
Disp3 G A 4: 148,344,387 (GRCm39) P505L probably benign Het
Dlec1 A T 9: 118,941,170 (GRCm39) Q240L probably benign Het
Dnai4 T C 4: 102,905,523 (GRCm39) K753E probably benign Het
Edil3 T A 13: 89,437,575 (GRCm39) I392N probably damaging Het
Epha10 T A 4: 124,796,486 (GRCm39) S398R Het
Ephb1 A G 9: 101,887,247 (GRCm39) I464T possibly damaging Het
Eps15 T A 4: 109,137,599 (GRCm39) probably null Het
Fam111a T A 19: 12,564,706 (GRCm39) C152S probably damaging Het
Flt3 T C 5: 147,291,653 (GRCm39) E599G probably damaging Het
Frmd3 T C 4: 74,077,482 (GRCm39) S259P probably benign Het
Hsfy2 A G 1: 56,675,461 (GRCm39) Y359H possibly damaging Het
Ifih1 C T 2: 62,476,037 (GRCm39) V80M possibly damaging Het
Il12rb2 A C 6: 67,269,358 (GRCm39) D818E probably damaging Het
Il4i1 A G 7: 44,489,236 (GRCm39) T334A probably benign Het
Irs2 G A 8: 11,054,659 (GRCm39) Q1258* probably null Het
Lsm1 T G 8: 26,283,721 (GRCm39) H44Q probably benign Het
Mgam A T 6: 40,727,099 (GRCm39) M1257L probably damaging Het
Myc T C 15: 61,860,001 (GRCm39) S225P probably damaging Het
Myh1 T C 11: 67,111,286 (GRCm39) V1575A probably benign Het
Myo9b A G 8: 71,775,949 (GRCm39) D380G probably damaging Het
Ncoa7 T A 10: 30,572,188 (GRCm39) D157V probably damaging Het
Or10g9b T A 9: 39,917,753 (GRCm39) H164L probably benign Het
Or2t44 G T 11: 58,677,472 (GRCm39) Q137H probably benign Het
Or7g16 G A 9: 18,727,188 (GRCm39) T134M probably benign Het
Or8b36 T C 9: 37,937,129 (GRCm39) V9A probably damaging Het
Or8b9 A C 9: 37,766,810 (GRCm39) E232A possibly damaging Het
Pccb A G 9: 100,905,268 (GRCm39) V117A probably damaging Het
Pdp2 C T 8: 105,321,131 (GRCm39) H327Y probably damaging Het
Pdzph1 G T 17: 59,281,431 (GRCm39) Q284K probably benign Het
Phka2 G A X: 159,316,044 (GRCm39) V230I probably damaging Het
Phldb1 A T 9: 44,610,865 (GRCm39) S751R probably damaging Het
Pira1 T C 7: 3,739,002 (GRCm39) H535R probably benign Het
Ppp1r1b T A 11: 98,240,002 (GRCm39) probably null Het
Ppp1r3a A G 6: 14,719,570 (GRCm39) V448A probably benign Het
Pvrig-ps A T 5: 138,340,312 (GRCm39) T28S probably benign Het
Rasgrf1 G A 9: 89,892,537 (GRCm39) probably null Het
Scnn1g T C 7: 121,339,576 (GRCm39) L125S probably damaging Het
Slc30a7 A T 3: 115,775,460 (GRCm39) D221E probably benign Het
Spata31e1 T A 13: 49,940,872 (GRCm39) R279S probably benign Het
Tmem30c A G 16: 57,101,622 (GRCm39) probably null Het
Tmem33 T C 5: 67,421,802 (GRCm39) probably null Het
Ttc29 A T 8: 79,060,249 (GRCm39) T390S probably benign Het
Vamp5 G A 6: 72,357,424 (GRCm39) probably benign Het
Vmn2r81 T A 10: 79,104,439 (GRCm39) F354Y probably benign Het
Vmn2r96 A G 17: 18,802,116 (GRCm39) H119R probably benign Het
Wdr3 G A 3: 100,046,041 (GRCm39) R931* probably null Het
Wtap A T 17: 13,186,397 (GRCm39) N383K probably damaging Het
Zfp808 T C 13: 62,320,849 (GRCm39) Y693H probably damaging Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53,435,743 (GRCm39) missense probably damaging 1.00
IGL00466:Atm APN 9 53,410,412 (GRCm39) splice site probably benign
IGL00567:Atm APN 9 53,414,416 (GRCm39) nonsense probably null
IGL00702:Atm APN 9 53,423,131 (GRCm39) missense probably benign 0.02
IGL00743:Atm APN 9 53,424,416 (GRCm39) missense probably benign 0.00
IGL00771:Atm APN 9 53,404,354 (GRCm39) missense probably benign 0.01
IGL00773:Atm APN 9 53,433,444 (GRCm39) missense probably benign 0.00
IGL00819:Atm APN 9 53,429,831 (GRCm39) missense probably damaging 1.00
IGL00864:Atm APN 9 53,445,233 (GRCm39) missense probably damaging 0.99
IGL00985:Atm APN 9 53,371,116 (GRCm39) missense probably damaging 0.98
IGL01109:Atm APN 9 53,401,593 (GRCm39) missense probably damaging 1.00
IGL01120:Atm APN 9 53,372,422 (GRCm39) critical splice acceptor site probably null
IGL01369:Atm APN 9 53,426,617 (GRCm39) missense probably benign
IGL01374:Atm APN 9 53,443,024 (GRCm39) missense possibly damaging 0.58
IGL01406:Atm APN 9 53,351,046 (GRCm39) makesense probably null
IGL01409:Atm APN 9 53,410,471 (GRCm39) missense probably benign 0.01
IGL01434:Atm APN 9 53,419,107 (GRCm39) missense probably benign 0.04
IGL01486:Atm APN 9 53,421,513 (GRCm39) missense probably benign
IGL01583:Atm APN 9 53,395,547 (GRCm39) splice site probably benign
IGL01861:Atm APN 9 53,405,912 (GRCm39) missense probably null 0.89
IGL01865:Atm APN 9 53,372,302 (GRCm39) missense probably damaging 1.00
IGL02026:Atm APN 9 53,353,717 (GRCm39) splice site probably null
IGL02072:Atm APN 9 53,371,096 (GRCm39) missense probably benign 0.01
IGL02075:Atm APN 9 53,438,537 (GRCm39) missense probably damaging 1.00
IGL02127:Atm APN 9 53,399,283 (GRCm39) missense probably damaging 1.00
IGL02175:Atm APN 9 53,391,965 (GRCm39) missense probably damaging 0.99
IGL02246:Atm APN 9 53,438,485 (GRCm39) missense probably benign 0.12
IGL02259:Atm APN 9 53,429,794 (GRCm39) splice site probably benign
IGL02351:Atm APN 9 53,433,476 (GRCm39) missense probably benign 0.04
IGL02358:Atm APN 9 53,433,476 (GRCm39) missense probably benign 0.04
IGL02387:Atm APN 9 53,391,066 (GRCm39) splice site probably null
IGL02417:Atm APN 9 53,390,995 (GRCm39) missense probably benign 0.00
IGL02422:Atm APN 9 53,412,092 (GRCm39) missense probably damaging 1.00
IGL02445:Atm APN 9 53,365,630 (GRCm39) missense probably benign 0.00
IGL02492:Atm APN 9 53,367,159 (GRCm39) missense probably damaging 0.99
IGL02513:Atm APN 9 53,408,562 (GRCm39) splice site probably benign
IGL02633:Atm APN 9 53,359,453 (GRCm39) missense probably damaging 1.00
IGL02634:Atm APN 9 53,427,863 (GRCm39) missense probably benign 0.00
IGL02948:Atm APN 9 53,364,740 (GRCm39) splice site probably benign
IGL02959:Atm APN 9 53,382,718 (GRCm39) missense probably damaging 1.00
IGL02965:Atm APN 9 53,364,863 (GRCm39) missense probably damaging 1.00
IGL03085:Atm APN 9 53,395,471 (GRCm39) missense possibly damaging 0.89
antebellum UTSW 9 53,429,859 (GRCm39) nonsense probably null
bull_run UTSW 9 53,399,222 (GRCm39) missense probably benign 0.09
Civil UTSW 9 53,403,568 (GRCm39) missense possibly damaging 0.78
gettysburg UTSW 9 53,367,288 (GRCm39) splice site probably null
Grant UTSW 9 53,423,217 (GRCm39) nonsense probably null
Indicative UTSW 9 53,356,676 (GRCm39) splice site probably null
Marker UTSW 9 53,365,579 (GRCm39) splice site probably benign
maunder UTSW 9 53,410,497 (GRCm39) nonsense probably null
mockingbird UTSW 9 53,427,767 (GRCm39) nonsense probably null
mockingbird2 UTSW 9 53,399,887 (GRCm39) missense probably damaging 1.00
osphere UTSW 9 53,390,973 (GRCm39) missense probably damaging 0.99
shiloh UTSW 9 53,376,598 (GRCm39) missense probably damaging 1.00
Strato UTSW 9 53,414,318 (GRCm39) missense probably damaging 1.00
thrasher UTSW 9 53,356,807 (GRCm39) missense probably benign 0.01
Tropo UTSW 9 53,442,948 (GRCm39) missense probably damaging 1.00
P0019:Atm UTSW 9 53,376,328 (GRCm39) splice site probably benign
PIT4403001:Atm UTSW 9 53,412,282 (GRCm39) missense probably benign
PIT4687001:Atm UTSW 9 53,398,112 (GRCm39) critical splice donor site probably null
R0004:Atm UTSW 9 53,364,828 (GRCm39) splice site probably benign
R0035:Atm UTSW 9 53,424,480 (GRCm39) missense probably benign 0.01
R0098:Atm UTSW 9 53,429,869 (GRCm39) missense probably benign 0.10
R0098:Atm UTSW 9 53,429,869 (GRCm39) missense probably benign 0.10
R0201:Atm UTSW 9 53,365,579 (GRCm39) splice site probably benign
R0304:Atm UTSW 9 53,427,644 (GRCm39) missense probably benign 0.34
R0308:Atm UTSW 9 53,365,773 (GRCm39) splice site probably null
R0362:Atm UTSW 9 53,370,138 (GRCm39) missense possibly damaging 0.90
R0470:Atm UTSW 9 53,372,266 (GRCm39) missense probably damaging 1.00
R0513:Atm UTSW 9 53,415,248 (GRCm39) missense probably benign 0.00
R0589:Atm UTSW 9 53,401,492 (GRCm39) missense possibly damaging 0.51
R0617:Atm UTSW 9 53,370,241 (GRCm39) nonsense probably null
R0630:Atm UTSW 9 53,442,922 (GRCm39) splice site probably benign
R0652:Atm UTSW 9 53,397,314 (GRCm39) missense probably damaging 0.98
R0698:Atm UTSW 9 53,426,539 (GRCm39) missense probably damaging 1.00
R0737:Atm UTSW 9 53,367,866 (GRCm39) missense probably damaging 1.00
R0885:Atm UTSW 9 53,371,123 (GRCm39) missense probably benign
R0947:Atm UTSW 9 53,415,392 (GRCm39) missense probably benign 0.01
R0948:Atm UTSW 9 53,407,258 (GRCm39) missense probably benign
R1144:Atm UTSW 9 53,422,998 (GRCm39) splice site probably benign
R1252:Atm UTSW 9 53,367,140 (GRCm39) missense probably damaging 1.00
R1295:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1296:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1419:Atm UTSW 9 53,368,789 (GRCm39) missense probably benign 0.00
R1477:Atm UTSW 9 53,375,573 (GRCm39) missense probably benign 0.00
R1596:Atm UTSW 9 53,364,678 (GRCm39) missense probably damaging 1.00
R1630:Atm UTSW 9 53,390,973 (GRCm39) missense probably damaging 0.99
R1667:Atm UTSW 9 53,412,232 (GRCm39) missense probably damaging 1.00
R1681:Atm UTSW 9 53,433,455 (GRCm39) missense possibly damaging 0.94
R1703:Atm UTSW 9 53,412,000 (GRCm39) missense probably benign
R1817:Atm UTSW 9 53,403,533 (GRCm39) splice site probably benign
R1840:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1848:Atm UTSW 9 53,379,312 (GRCm39) missense probably benign 0.06
R1906:Atm UTSW 9 53,417,868 (GRCm39) missense probably damaging 1.00
R1958:Atm UTSW 9 53,382,718 (GRCm39) missense probably damaging 1.00
R2108:Atm UTSW 9 53,355,297 (GRCm39) missense probably damaging 1.00
R2116:Atm UTSW 9 53,412,269 (GRCm39) missense probably benign 0.36
R2134:Atm UTSW 9 53,379,264 (GRCm39) critical splice donor site probably null
R2137:Atm UTSW 9 53,364,675 (GRCm39) missense probably damaging 1.00
R2291:Atm UTSW 9 53,402,209 (GRCm39) splice site probably null
R2348:Atm UTSW 9 53,403,568 (GRCm39) missense possibly damaging 0.78
R2483:Atm UTSW 9 53,421,566 (GRCm39) missense probably damaging 1.00
R2567:Atm UTSW 9 53,368,770 (GRCm39) missense possibly damaging 0.72
R2897:Atm UTSW 9 53,419,105 (GRCm39) missense probably damaging 0.99
R2939:Atm UTSW 9 53,406,011 (GRCm39) missense probably damaging 1.00
R3008:Atm UTSW 9 53,392,050 (GRCm39) missense probably benign 0.00
R3236:Atm UTSW 9 53,391,048 (GRCm39) missense probably benign 0.15
R3847:Atm UTSW 9 53,414,375 (GRCm39) missense possibly damaging 0.94
R3889:Atm UTSW 9 53,417,936 (GRCm39) splice site probably benign
R3919:Atm UTSW 9 53,403,578 (GRCm39) missense probably benign 0.00
R4125:Atm UTSW 9 53,361,921 (GRCm39) missense probably damaging 1.00
R4222:Atm UTSW 9 53,391,969 (GRCm39) missense probably benign
R4395:Atm UTSW 9 53,376,527 (GRCm39) missense probably benign 0.09
R4466:Atm UTSW 9 53,359,469 (GRCm39) nonsense probably null
R4502:Atm UTSW 9 53,407,246 (GRCm39) missense possibly damaging 0.92
R4514:Atm UTSW 9 53,404,339 (GRCm39) missense probably damaging 0.99
R4528:Atm UTSW 9 53,412,059 (GRCm39) missense probably benign 0.39
R4593:Atm UTSW 9 53,364,894 (GRCm39) missense possibly damaging 0.55
R4627:Atm UTSW 9 53,367,806 (GRCm39) missense possibly damaging 0.79
R4634:Atm UTSW 9 53,443,033 (GRCm39) missense probably benign 0.01
R4665:Atm UTSW 9 53,375,529 (GRCm39) missense probably benign 0.00
R4672:Atm UTSW 9 53,433,501 (GRCm39) missense probably damaging 0.99
R4741:Atm UTSW 9 53,364,907 (GRCm39) missense probably benign 0.10
R4808:Atm UTSW 9 53,356,795 (GRCm39) missense probably damaging 0.99
R4959:Atm UTSW 9 53,426,601 (GRCm39) missense probably benign
R4996:Atm UTSW 9 53,435,807 (GRCm39) missense probably benign 0.09
R5030:Atm UTSW 9 53,431,409 (GRCm39) nonsense probably null
R5214:Atm UTSW 9 53,402,327 (GRCm39) missense probably benign 0.09
R5260:Atm UTSW 9 53,417,911 (GRCm39) missense probably damaging 0.99
R5311:Atm UTSW 9 53,429,923 (GRCm39) missense probably benign 0.00
R5394:Atm UTSW 9 53,419,077 (GRCm39) critical splice donor site probably null
R5400:Atm UTSW 9 53,414,318 (GRCm39) missense probably damaging 1.00
R5436:Atm UTSW 9 53,371,104 (GRCm39) missense probably benign 0.00
R5441:Atm UTSW 9 53,427,767 (GRCm39) nonsense probably null
R5569:Atm UTSW 9 53,427,750 (GRCm39) nonsense probably null
R5856:Atm UTSW 9 53,407,255 (GRCm39) missense possibly damaging 0.64
R5891:Atm UTSW 9 53,408,459 (GRCm39) missense probably benign
R5910:Atm UTSW 9 53,359,380 (GRCm39) missense probably damaging 0.96
R6054:Atm UTSW 9 53,371,173 (GRCm39) missense probably damaging 1.00
R6062:Atm UTSW 9 53,399,887 (GRCm39) missense probably damaging 1.00
R6092:Atm UTSW 9 53,435,714 (GRCm39) missense probably damaging 1.00
R6127:Atm UTSW 9 53,435,809 (GRCm39) missense probably damaging 1.00
R6160:Atm UTSW 9 53,402,259 (GRCm39) missense probably benign 0.04
R6267:Atm UTSW 9 53,355,300 (GRCm39) missense probably damaging 1.00
R6273:Atm UTSW 9 53,399,222 (GRCm39) missense probably benign 0.09
R6284:Atm UTSW 9 53,356,676 (GRCm39) splice site probably null
R6478:Atm UTSW 9 53,401,554 (GRCm39) missense probably damaging 1.00
R6547:Atm UTSW 9 53,351,457 (GRCm39) missense probably damaging 1.00
R6549:Atm UTSW 9 53,404,477 (GRCm39) missense probably benign 0.00
R6704:Atm UTSW 9 53,370,153 (GRCm39) missense probably benign 0.02
R6715:Atm UTSW 9 53,442,948 (GRCm39) missense probably damaging 1.00
R6737:Atm UTSW 9 53,397,351 (GRCm39) missense probably benign 0.30
R6759:Atm UTSW 9 53,429,859 (GRCm39) nonsense probably null
R6766:Atm UTSW 9 53,401,582 (GRCm39) missense probably damaging 0.99
R6852:Atm UTSW 9 53,393,730 (GRCm39) missense possibly damaging 0.93
R7064:Atm UTSW 9 53,419,181 (GRCm39) missense probably benign 0.02
R7208:Atm UTSW 9 53,423,308 (GRCm39) splice site probably null
R7211:Atm UTSW 9 53,399,860 (GRCm39) missense probably benign 0.01
R7220:Atm UTSW 9 53,423,217 (GRCm39) nonsense probably null
R7336:Atm UTSW 9 53,373,803 (GRCm39) missense possibly damaging 0.47
R7363:Atm UTSW 9 53,376,598 (GRCm39) missense probably damaging 1.00
R7378:Atm UTSW 9 53,364,737 (GRCm39) critical splice acceptor site probably null
R7472:Atm UTSW 9 53,359,425 (GRCm39) missense possibly damaging 0.81
R7487:Atm UTSW 9 53,435,654 (GRCm39) missense probably benign
R7497:Atm UTSW 9 53,423,191 (GRCm39) missense probably benign 0.00
R7584:Atm UTSW 9 53,424,427 (GRCm39) missense probably damaging 0.99
R7624:Atm UTSW 9 53,366,068 (GRCm39) missense probably damaging 0.99
R7653:Atm UTSW 9 53,401,602 (GRCm39) nonsense probably null
R7660:Atm UTSW 9 53,356,807 (GRCm39) missense probably benign 0.01
R7679:Atm UTSW 9 53,353,797 (GRCm39) missense probably damaging 1.00
R7720:Atm UTSW 9 53,433,539 (GRCm39) missense possibly damaging 0.54
R8221:Atm UTSW 9 53,367,288 (GRCm39) splice site probably null
R8247:Atm UTSW 9 53,361,870 (GRCm39) missense
R8334:Atm UTSW 9 53,433,573 (GRCm39) missense probably benign 0.00
R8503:Atm UTSW 9 53,399,352 (GRCm39) missense probably damaging 0.99
R8552:Atm UTSW 9 53,435,797 (GRCm39) missense probably damaging 1.00
R8749:Atm UTSW 9 53,410,497 (GRCm39) nonsense probably null
R8838:Atm UTSW 9 53,427,851 (GRCm39) missense probably damaging 0.99
R9126:Atm UTSW 9 53,370,134 (GRCm39) missense probably benign 0.01
R9131:Atm UTSW 9 53,445,044 (GRCm39) missense probably benign 0.10
R9191:Atm UTSW 9 53,438,590 (GRCm39) missense probably benign 0.29
R9257:Atm UTSW 9 53,407,150 (GRCm39) critical splice donor site probably null
R9473:Atm UTSW 9 53,410,272 (GRCm39) missense probably benign
R9558:Atm UTSW 9 53,412,081 (GRCm39) missense probably benign 0.00
R9598:Atm UTSW 9 53,431,381 (GRCm39) missense probably benign 0.34
R9717:Atm UTSW 9 53,427,817 (GRCm39) missense probably damaging 1.00
R9794:Atm UTSW 9 53,429,867 (GRCm39) missense probably benign
X0067:Atm UTSW 9 53,390,994 (GRCm39) missense probably benign 0.00
Z1088:Atm UTSW 9 53,442,987 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGACTCCAGTGTGCTAGAG -3'
(R):5'- TCTTTCTGACAACCCGAGTTTAATG -3'

Sequencing Primer
(F):5'- TCGACTCCAGTGTGCTAGAGAAATAC -3'
(R):5'- GACAACCCGAGTTTAATGTTCAAATC -3'
Posted On 2018-09-12