Mutagenetix > Incidental Mutations

Incidental Mutation 'R6813:Rasgrf1'

533960

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf1

Ensembl Gene

ENSMUSG00000032356

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 1

Synonyms

CDC25, Grfbeta, CDC25Mm, Grf1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6813 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89909908-90026977 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 90010484 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034912 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034912]

AlphaFold

P27671

PDB Structure

Crystal Structure of the Cdc25 domain of RasGRF1 [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000034912

SMART Domains

Protein: ENSMUSP00000034912
Gene: ENSMUSG00000032356

Domain	Start	End	E-Value	Type
PH	23	132	2.48e-18	SMART
Blast:RhoGEF	146	196	4e-6	BLAST
IQ	205	227	5.27e0	SMART
RhoGEF	248	429	1.96e-57	SMART
PH	461	590	1.51e-8	SMART
RasGEFN	634	767	3.07e-10	SMART
low complexity region	844	855	N/A	INTRINSIC
RasGEFN	869	997	5.86e-7	SMART
RasGEF	1023	1260	1.85e-99	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 96.9%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) similar to the Saccharomyces cerevisiae CDC25 gene product. Functional analysis has demonstrated that this protein stimulates the dissociation of GDP from RAS protein. The studies of the similar gene in mouse suggested that the Ras-GEF activity of this protein in brain can be activated by Ca2+ influx, muscarinic receptors, and G protein beta-gamma subunit. Mouse studies also indicated that the Ras-GEF signaling pathway mediated by this protein may be important for long-term memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for null mutations (and heterozygotes with a paternally inherited mutant allele) exhibit reduced postnatal growth, low insulin and IGF I levels, glucose intolerance, beta-cell hypoplasia, impaired long-term synaptic plasticity, and impaired hippocampal-dependent learning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,229,282	N2337K	probably benign	Het
Adgrb2	C	A	4: 130,009,491	Q603K	probably damaging	Het
Adgrf3	A	G	5: 30,197,521	F503S	probably damaging	Het
Arfgap3	A	T	15: 83,330,593	M164K	probably benign	Het
Asb13	G	T	13: 3,645,029	V166F	probably damaging	Het
Atm	T	G	9: 53,497,235	R1103S	probably benign	Het
Atxn7l1	T	C	12: 33,367,124	I626T	probably damaging	Het
Brsk2	A	G	7: 142,002,477	I649V	probably benign	Het
Ccdc25	T	A	14: 65,856,433	M85K	probably benign	Het
Cdc42bpb	A	G	12: 111,327,615	V231A	probably damaging	Het
Clstn3	T	A	6: 124,436,935	M767L	probably benign	Het
Col6a6	C	T	9: 105,783,941	R323K	probably benign	Het
Creld1	A	G	6: 113,489,569	Y199C	probably damaging	Het
Csf1r	T	A	18: 61,112,734	D254E	probably benign	Het
Dab2ip	C	T	2: 35,730,473	Q1118*	probably null	Het
Dcun1d4	C	A	5: 73,520,957	S98R	possibly damaging	Het
Disp3	G	A	4: 148,259,930	P505L	probably benign	Het
Dlec1	A	T	9: 119,112,102	Q240L	probably benign	Het
Edil3	T	A	13: 89,289,456	I392N	probably damaging	Het
Epha10	T	A	4: 124,902,693	S398R		Het
Ephb1	A	G	9: 102,010,048	I464T	possibly damaging	Het
Eps15	T	A	4: 109,280,402		probably null	Het
Fam111a	T	A	19: 12,587,342	C152S	probably damaging	Het
Flt3	T	C	5: 147,354,843	E599G	probably damaging	Het
Frmd3	T	C	4: 74,159,245	S259P	probably benign	Het
Gm15922	T	C	7: 3,736,003	H535R	probably benign	Het
Gm30302	T	A	13: 49,787,396	R279S	probably benign	Het
Hsfy2	A	G	1: 56,636,302	Y359H	possibly damaging	Het
Ifih1	C	T	2: 62,645,693	V80M	possibly damaging	Het
Il12rb2	A	C	6: 67,292,374	D818E	probably damaging	Het
Il4i1	A	G	7: 44,839,812	T334A	probably benign	Het
Irs2	G	A	8: 11,004,659	Q1258*	probably null	Het
Lsm1	T	G	8: 25,793,693	H44Q	probably benign	Het
Mgam	A	T	6: 40,750,165	M1257L	probably damaging	Het
Myc	T	C	15: 61,988,152	S225P	probably damaging	Het
Myh1	T	C	11: 67,220,460	V1575A	probably benign	Het
Myo9b	A	G	8: 71,323,305	D380G	probably damaging	Het
Ncoa7	T	A	10: 30,696,192	D157V	probably damaging	Het
Olfr314	G	T	11: 58,786,646	Q137H	probably benign	Het
Olfr828	G	A	9: 18,815,892	T134M	probably benign	Het
Olfr877	A	C	9: 37,855,514	E232A	possibly damaging	Het
Olfr883	T	C	9: 38,025,833	V9A	probably damaging	Het
Olfr980	T	A	9: 40,006,457	H164L	probably benign	Het
Pccb	A	G	9: 101,023,215	V117A	probably damaging	Het
Pdp2	C	T	8: 104,594,499	H327Y	probably damaging	Het
Pdzph1	G	T	17: 58,974,436	Q284K	probably benign	Het
Phka2	G	A	X: 160,533,048	V230I	probably damaging	Het
Phldb1	A	T	9: 44,699,568	S751R	probably damaging	Het
Ppp1r1b	T	A	11: 98,349,176		probably null	Het
Ppp1r3a	A	G	6: 14,719,571	V448A	probably benign	Het
Pvrig	A	T	5: 138,342,050	T28S	probably benign	Het
Scnn1g	T	C	7: 121,740,353	L125S	probably damaging	Het
Slc30a7	A	T	3: 115,981,811	D221E	probably benign	Het
Tmem30c	A	G	16: 57,281,259		probably null	Het
Tmem33	T	C	5: 67,264,459		probably null	Het
Ttc29	A	T	8: 78,333,620	T390S	probably benign	Het
Vamp5	G	A	6: 72,380,441		probably benign	Het
Vmn2r81	T	A	10: 79,268,605	F354Y	probably benign	Het
Vmn2r96	A	G	17: 18,581,854	H119R	probably benign	Het
Wdr3	G	A	3: 100,138,725	R931*	probably null	Het
Wdr78	T	C	4: 103,048,326	K753E	probably benign	Het
Wtap	A	T	17: 12,967,510	N383K	probably damaging	Het
Zfp808	T	C	13: 62,173,035	Y693H	probably damaging	Het

Other mutations in Rasgrf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Rasgrf1	APN	9	89970481	missense	probably damaging	1.00
IGL00763:Rasgrf1	APN	9	89971020	missense	probably benign	0.05
IGL01336:Rasgrf1	APN	9	89991530	missense	probably benign	0.00
IGL01710:Rasgrf1	APN	9	89991692	missense	probably benign	0.18
IGL01807:Rasgrf1	APN	9	89991513	missense	probably damaging	0.99
IGL01939:Rasgrf1	APN	9	89974836	missense	probably damaging	0.99
IGL02453:Rasgrf1	APN	9	89944760	missense	possibly damaging	0.76
IGL02961:Rasgrf1	APN	9	89981649	missense	possibly damaging	0.88
IGL03009:Rasgrf1	APN	9	89991703	missense	possibly damaging	0.75
IGL03369:Rasgrf1	APN	9	90010451	missense	probably damaging	1.00
IGL03373:Rasgrf1	APN	9	90017031	splice site	probably benign
Malenkiy	UTSW	9	90010484	splice site	probably null
Pigeon	UTSW	9	89967915	missense	probably damaging	1.00
PIT4142001:Rasgrf1	UTSW	9	89915573	missense	possibly damaging	0.91
R0234:Rasgrf1	UTSW	9	90009366	missense	probably damaging	1.00
R0629:Rasgrf1	UTSW	9	89984269	missense	probably damaging	1.00
R0685:Rasgrf1	UTSW	9	89915482	utr 3 prime	probably benign
R0730:Rasgrf1	UTSW	9	89951009	splice site	probably benign
R0835:Rasgrf1	UTSW	9	90000771	missense	probably benign
R1432:Rasgrf1	UTSW	9	90012800	missense	probably benign	0.35
R1647:Rasgrf1	UTSW	9	89953920	missense	probably benign	0.28
R1717:Rasgrf1	UTSW	9	89953913	missense	probably damaging	0.98
R1933:Rasgrf1	UTSW	9	89953913	missense	probably damaging	0.98
R1934:Rasgrf1	UTSW	9	89953913	missense	probably damaging	0.98
R2187:Rasgrf1	UTSW	9	89994835	missense	possibly damaging	0.93
R2240:Rasgrf1	UTSW	9	89976762	missense	probably damaging	0.99
R2940:Rasgrf1	UTSW	9	89991714	missense	possibly damaging	0.84
R3949:Rasgrf1	UTSW	9	89981744	splice site	probably benign
R4751:Rasgrf1	UTSW	9	89910118	missense	probably damaging	1.00
R4751:Rasgrf1	UTSW	9	90012866	missense	probably damaging	1.00
R4901:Rasgrf1	UTSW	9	89995003	missense	probably benign	0.00
R4910:Rasgrf1	UTSW	9	89976752	missense	probably benign	0.00
R4961:Rasgrf1	UTSW	9	89944869	missense	probably benign	0.06
R5270:Rasgrf1	UTSW	9	90026694	missense	probably benign	0.00
R5320:Rasgrf1	UTSW	9	90020425	missense	probably damaging	0.99
R5602:Rasgrf1	UTSW	9	89911571	missense	possibly damaging	0.73
R5659:Rasgrf1	UTSW	9	89984289	missense	probably damaging	1.00
R5960:Rasgrf1	UTSW	9	90021384	missense	possibly damaging	0.69
R6074:Rasgrf1	UTSW	9	89953915	missense	probably benign	0.01
R6400:Rasgrf1	UTSW	9	89991630	missense	probably damaging	1.00
R6596:Rasgrf1	UTSW	9	90012794	missense	possibly damaging	0.92
R6603:Rasgrf1	UTSW	9	89910257	missense	probably damaging	0.96
R6647:Rasgrf1	UTSW	9	90010463	missense	probably benign	0.00
R7136:Rasgrf1	UTSW	9	89991598	missense	probably damaging	1.00
R7155:Rasgrf1	UTSW	9	90002361	missense	possibly damaging	0.90
R7175:Rasgrf1	UTSW	9	89980749	missense	probably benign	0.02
R7202:Rasgrf1	UTSW	9	90017072	missense	possibly damaging	0.49
R7219:Rasgrf1	UTSW	9	89984288	missense	probably damaging	1.00
R7244:Rasgrf1	UTSW	9	89994757	missense	probably damaging	1.00
R7733:Rasgrf1	UTSW	9	89981727	missense	probably benign	0.01
R7764:Rasgrf1	UTSW	9	89994694	missense	possibly damaging	0.94
R8210:Rasgrf1	UTSW	9	89911622	missense	unknown
R8421:Rasgrf1	UTSW	9	89967915	missense	probably damaging	1.00
R8524:Rasgrf1	UTSW	9	89915585	missense	possibly damaging	0.53
R8526:Rasgrf1	UTSW	9	89974848	missense	probably damaging	0.96
R8697:Rasgrf1	UTSW	9	89995002	missense	probably benign
R9133:Rasgrf1	UTSW	9	89911547	missense	probably benign
R9153:Rasgrf1	UTSW	9	89944737	missense	probably damaging	1.00
R9191:Rasgrf1	UTSW	9	90001870	missense	probably damaging	1.00
R9349:Rasgrf1	UTSW	9	90002407	missense	probably damaging	0.99
Z1177:Rasgrf1	UTSW	9	89950917	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCACAACACACTGCTTG -3'
(R):5'- GCACCCTGGATGTATGCTTG -3'

Sequencing Primer
(F):5'- ACACACTGCTTGGAACTGG -3'
(R):5'- TCCTAGTGCTGGAGATCCTAACAAG -3'

Posted On

2018-09-12