Incidental Mutation 'R6813:Rasgrf1'
ID 533960
Institutional Source Beutler Lab
Gene Symbol Rasgrf1
Ensembl Gene ENSMUSG00000032356
Gene Name RAS protein-specific guanine nucleotide-releasing factor 1
Synonyms CDC25, Grfbeta, CDC25Mm, Grf1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 89909908-90026977 bp(+) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 90010484 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034912]
AlphaFold P27671
PDB Structure Crystal Structure of the Cdc25 domain of RasGRF1 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000034912
SMART Domains Protein: ENSMUSP00000034912
Gene: ENSMUSG00000032356

DomainStartEndE-ValueType
PH 23 132 2.48e-18 SMART
Blast:RhoGEF 146 196 4e-6 BLAST
IQ 205 227 5.27e0 SMART
RhoGEF 248 429 1.96e-57 SMART
PH 461 590 1.51e-8 SMART
RasGEFN 634 767 3.07e-10 SMART
low complexity region 844 855 N/A INTRINSIC
RasGEFN 869 997 5.86e-7 SMART
RasGEF 1023 1260 1.85e-99 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) similar to the Saccharomyces cerevisiae CDC25 gene product. Functional analysis has demonstrated that this protein stimulates the dissociation of GDP from RAS protein. The studies of the similar gene in mouse suggested that the Ras-GEF activity of this protein in brain can be activated by Ca2+ influx, muscarinic receptors, and G protein beta-gamma subunit. Mouse studies also indicated that the Ras-GEF signaling pathway mediated by this protein may be important for long-term memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for null mutations (and heterozygotes with a paternally inherited mutant allele) exhibit reduced postnatal growth, low insulin and IGF I levels, glucose intolerance, beta-cell hypoplasia, impaired long-term synaptic plasticity, and impaired hippocampal-dependent learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Rasgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Rasgrf1 APN 9 89970481 missense probably damaging 1.00
IGL00763:Rasgrf1 APN 9 89971020 missense probably benign 0.05
IGL01336:Rasgrf1 APN 9 89991530 missense probably benign 0.00
IGL01710:Rasgrf1 APN 9 89991692 missense probably benign 0.18
IGL01807:Rasgrf1 APN 9 89991513 missense probably damaging 0.99
IGL01939:Rasgrf1 APN 9 89974836 missense probably damaging 0.99
IGL02453:Rasgrf1 APN 9 89944760 missense possibly damaging 0.76
IGL02961:Rasgrf1 APN 9 89981649 missense possibly damaging 0.88
IGL03009:Rasgrf1 APN 9 89991703 missense possibly damaging 0.75
IGL03369:Rasgrf1 APN 9 90010451 missense probably damaging 1.00
IGL03373:Rasgrf1 APN 9 90017031 splice site probably benign
Malenkiy UTSW 9 90010484 splice site probably null
Pigeon UTSW 9 89967915 missense probably damaging 1.00
PIT4142001:Rasgrf1 UTSW 9 89915573 missense possibly damaging 0.91
R0234:Rasgrf1 UTSW 9 90009366 missense probably damaging 1.00
R0629:Rasgrf1 UTSW 9 89984269 missense probably damaging 1.00
R0685:Rasgrf1 UTSW 9 89915482 utr 3 prime probably benign
R0730:Rasgrf1 UTSW 9 89951009 splice site probably benign
R0835:Rasgrf1 UTSW 9 90000771 missense probably benign
R1432:Rasgrf1 UTSW 9 90012800 missense probably benign 0.35
R1647:Rasgrf1 UTSW 9 89953920 missense probably benign 0.28
R1717:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R1933:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R1934:Rasgrf1 UTSW 9 89953913 missense probably damaging 0.98
R2187:Rasgrf1 UTSW 9 89994835 missense possibly damaging 0.93
R2240:Rasgrf1 UTSW 9 89976762 missense probably damaging 0.99
R2940:Rasgrf1 UTSW 9 89991714 missense possibly damaging 0.84
R3949:Rasgrf1 UTSW 9 89981744 splice site probably benign
R4751:Rasgrf1 UTSW 9 89910118 missense probably damaging 1.00
R4751:Rasgrf1 UTSW 9 90012866 missense probably damaging 1.00
R4901:Rasgrf1 UTSW 9 89995003 missense probably benign 0.00
R4910:Rasgrf1 UTSW 9 89976752 missense probably benign 0.00
R4961:Rasgrf1 UTSW 9 89944869 missense probably benign 0.06
R5270:Rasgrf1 UTSW 9 90026694 missense probably benign 0.00
R5320:Rasgrf1 UTSW 9 90020425 missense probably damaging 0.99
R5602:Rasgrf1 UTSW 9 89911571 missense possibly damaging 0.73
R5659:Rasgrf1 UTSW 9 89984289 missense probably damaging 1.00
R5960:Rasgrf1 UTSW 9 90021384 missense possibly damaging 0.69
R6074:Rasgrf1 UTSW 9 89953915 missense probably benign 0.01
R6400:Rasgrf1 UTSW 9 89991630 missense probably damaging 1.00
R6596:Rasgrf1 UTSW 9 90012794 missense possibly damaging 0.92
R6603:Rasgrf1 UTSW 9 89910257 missense probably damaging 0.96
R6647:Rasgrf1 UTSW 9 90010463 missense probably benign 0.00
R7136:Rasgrf1 UTSW 9 89991598 missense probably damaging 1.00
R7155:Rasgrf1 UTSW 9 90002361 missense possibly damaging 0.90
R7175:Rasgrf1 UTSW 9 89980749 missense probably benign 0.02
R7202:Rasgrf1 UTSW 9 90017072 missense possibly damaging 0.49
R7219:Rasgrf1 UTSW 9 89984288 missense probably damaging 1.00
R7244:Rasgrf1 UTSW 9 89994757 missense probably damaging 1.00
R7733:Rasgrf1 UTSW 9 89981727 missense probably benign 0.01
R7764:Rasgrf1 UTSW 9 89994694 missense possibly damaging 0.94
R8210:Rasgrf1 UTSW 9 89911622 missense unknown
R8421:Rasgrf1 UTSW 9 89967915 missense probably damaging 1.00
R8524:Rasgrf1 UTSW 9 89915585 missense possibly damaging 0.53
R8526:Rasgrf1 UTSW 9 89974848 missense probably damaging 0.96
R8697:Rasgrf1 UTSW 9 89995002 missense probably benign
R9133:Rasgrf1 UTSW 9 89911547 missense probably benign
R9153:Rasgrf1 UTSW 9 89944737 missense probably damaging 1.00
R9191:Rasgrf1 UTSW 9 90001870 missense probably damaging 1.00
R9349:Rasgrf1 UTSW 9 90002407 missense probably damaging 0.99
Z1177:Rasgrf1 UTSW 9 89950917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACAACACACTGCTTG -3'
(R):5'- GCACCCTGGATGTATGCTTG -3'

Sequencing Primer
(F):5'- ACACACTGCTTGGAACTGG -3'
(R):5'- TCCTAGTGCTGGAGATCCTAACAAG -3'
Posted On 2018-09-12