Incidental Mutation 'R6813:Ncoa7'
ID 533965
Institutional Source Beutler Lab
Gene Symbol Ncoa7
Ensembl Gene ENSMUSG00000039697
Gene Name nuclear receptor coactivator 7
Synonyms 9030406N13Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172495; MGI: 2444847

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 30628999-30803326 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 30696192 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 157 (D157V)
Ref Sequence ENSEMBL: ENSMUSP00000150021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068567] [ENSMUST00000213836] [ENSMUST00000215725] [ENSMUST00000215740] [ENSMUST00000215926]
AlphaFold Q6DFV7
Predicted Effect probably damaging
Transcript: ENSMUST00000068567
AA Change: D195V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000066741
Gene: ENSMUSG00000039697
AA Change: D195V

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
LysM 118 161 2.24e-7 SMART
low complexity region 165 176 N/A INTRINSIC
TLDc 781 943 2.86e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213836
AA Change: D195V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215725
AA Change: D195V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215740
AA Change: D195V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000215926
AA Change: D157V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
Allele List at MGI

All alleles(108) : Gene trapped(108)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Ncoa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ncoa7 APN 10 30690840 missense probably damaging 1.00
IGL01716:Ncoa7 APN 10 30662334 missense probably damaging 0.96
IGL02114:Ncoa7 APN 10 30662364 missense probably damaging 1.00
IGL02170:Ncoa7 APN 10 30689853 missense possibly damaging 0.94
IGL02436:Ncoa7 APN 10 30694147 missense probably damaging 1.00
IGL02499:Ncoa7 APN 10 30690889 missense probably benign 0.04
IGL02533:Ncoa7 APN 10 30690899 missense possibly damaging 0.87
IGL02533:Ncoa7 APN 10 30722785 missense probably damaging 1.00
IGL02590:Ncoa7 APN 10 30694163 missense probably damaging 1.00
IGL02657:Ncoa7 APN 10 30652976 missense probably damaging 1.00
IGL03065:Ncoa7 APN 10 30647997 missense probably damaging 1.00
IGL03088:Ncoa7 APN 10 30698125 splice site probably null
IGL03090:Ncoa7 APN 10 30662400 missense probably damaging 0.96
IGL03196:Ncoa7 APN 10 30647514 utr 3 prime probably benign
D6062:Ncoa7 UTSW 10 30722655 missense probably damaging 1.00
R0058:Ncoa7 UTSW 10 30647541 missense probably damaging 1.00
R0058:Ncoa7 UTSW 10 30647541 missense probably damaging 1.00
R0578:Ncoa7 UTSW 10 30701917 critical splice donor site probably null
R0729:Ncoa7 UTSW 10 30691579 missense probably benign 0.00
R1538:Ncoa7 UTSW 10 30694211 missense probably damaging 0.99
R1539:Ncoa7 UTSW 10 30771729 missense probably damaging 1.00
R1574:Ncoa7 UTSW 10 30694101 missense probably damaging 1.00
R1574:Ncoa7 UTSW 10 30694101 missense probably damaging 1.00
R1624:Ncoa7 UTSW 10 30704659 missense possibly damaging 0.87
R1639:Ncoa7 UTSW 10 30701992 missense probably damaging 1.00
R1655:Ncoa7 UTSW 10 30698245 critical splice acceptor site probably null
R1876:Ncoa7 UTSW 10 30698126 intron probably benign
R1885:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1886:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1887:Ncoa7 UTSW 10 30648452 missense possibly damaging 0.81
R1909:Ncoa7 UTSW 10 30689800 missense probably damaging 1.00
R1938:Ncoa7 UTSW 10 30698170 missense probably benign 0.02
R1965:Ncoa7 UTSW 10 30654430 nonsense probably null
R1978:Ncoa7 UTSW 10 30691299 missense probably benign
R2303:Ncoa7 UTSW 10 30654435 missense probably damaging 1.00
R3777:Ncoa7 UTSW 10 30689756 missense probably damaging 1.00
R3778:Ncoa7 UTSW 10 30689756 missense probably damaging 1.00
R4026:Ncoa7 UTSW 10 30722724 missense probably benign 0.02
R4230:Ncoa7 UTSW 10 30698257 splice site probably null
R4667:Ncoa7 UTSW 10 30690790 missense probably damaging 1.00
R4786:Ncoa7 UTSW 10 30655642 missense probably benign 0.28
R4809:Ncoa7 UTSW 10 30771762 missense possibly damaging 0.92
R4820:Ncoa7 UTSW 10 30648476 missense probably damaging 1.00
R4839:Ncoa7 UTSW 10 30722659 missense possibly damaging 0.93
R4861:Ncoa7 UTSW 10 30704612 missense probably benign
R4861:Ncoa7 UTSW 10 30704612 missense probably benign
R5271:Ncoa7 UTSW 10 30722729 missense probably benign 0.02
R5384:Ncoa7 UTSW 10 30722817 missense probably benign 0.00
R5418:Ncoa7 UTSW 10 30648039 missense probably damaging 1.00
R5964:Ncoa7 UTSW 10 30704636 missense probably damaging 1.00
R6257:Ncoa7 UTSW 10 30694177 missense probably damaging 1.00
R6683:Ncoa7 UTSW 10 30771721 missense probably damaging 0.99
R6910:Ncoa7 UTSW 10 30694121 missense possibly damaging 0.89
R7123:Ncoa7 UTSW 10 30654439 missense probably benign 0.28
R7327:Ncoa7 UTSW 10 30689800 missense probably damaging 1.00
R7412:Ncoa7 UTSW 10 30722851 missense possibly damaging 0.94
R7638:Ncoa7 UTSW 10 30722798 missense probably benign 0.35
R7653:Ncoa7 UTSW 10 30694243 missense probably damaging 1.00
R7848:Ncoa7 UTSW 10 30648418 missense possibly damaging 0.82
R7861:Ncoa7 UTSW 10 30691060 missense probably benign 0.38
R8125:Ncoa7 UTSW 10 30694091 missense possibly damaging 0.80
R8198:Ncoa7 UTSW 10 30704668 missense probably benign 0.00
R8240:Ncoa7 UTSW 10 30691729 missense probably benign 0.45
R8353:Ncoa7 UTSW 10 30694159 missense probably damaging 1.00
R8509:Ncoa7 UTSW 10 30696052 missense probably benign 0.00
R8861:Ncoa7 UTSW 10 30691368 missense probably benign 0.02
R9040:Ncoa7 UTSW 10 30654393 missense probably benign 0.00
R9136:Ncoa7 UTSW 10 30691632 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCATGCACTTCAGTTGTGGG -3'
(R):5'- GAGCATGTGTCCTTCTTACCGG -3'

Sequencing Primer
(F):5'- CTTCAGTTGTGGGTAAAATACTCCC -3'
(R):5'- CATGTGTCCTTCTTACCGGTTAGAAG -3'
Posted On 2018-09-12