Incidental Mutation 'R6813:Myh1'
ID 533968
Institutional Source Beutler Lab
Gene Symbol Myh1
Ensembl Gene ENSMUSG00000056328
Gene Name myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms A530084A17Rik, Myhsf2, Myhs-f2, Myhs-f, IId/x, IId, myosin heavy chain 2X, MYHC-IIX, MyHC-IId/x
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 67200052-67224575 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67220460 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1575 (V1575A)
Ref Sequence ENSEMBL: ENSMUSP00000117569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018637] [ENSMUST00000075734] [ENSMUST00000124516]
AlphaFold Q5SX40
Predicted Effect probably benign
Transcript: ENSMUST00000018637
AA Change: V1575A

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000018637
Gene: ENSMUSG00000056328
AA Change: V1575A

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075734
AA Change: V1575A

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075147
Gene: ENSMUSG00000056328
AA Change: V1575A

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 7.2e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
Pfam:Myosin_tail_1 850 1931 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124516
AA Change: V1575A

PolyPhen 2 Score 0.341 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117569
Gene: ENSMUSG00000056328
AA Change: V1575A

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.8e-15 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 1.18e-3 SMART
low complexity region 860 883 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, muscular weakness, kyphosis, and abnormal kinetics of muscle contraction and relaxation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Myh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Myh1 APN 11 67220865 missense probably damaging 0.99
IGL00514:Myh1 APN 11 67219784 missense probably damaging 1.00
IGL00851:Myh1 APN 11 67217910 missense probably damaging 0.96
IGL01061:Myh1 APN 11 67217862 missense probably benign 0.05
IGL01113:Myh1 APN 11 67202180 missense probably benign 0.00
IGL01125:Myh1 APN 11 67220660 missense probably benign
IGL01391:Myh1 APN 11 67217863 missense probably benign 0.00
IGL01392:Myh1 APN 11 67221301 missense probably benign 0.20
IGL01404:Myh1 APN 11 67222151 missense possibly damaging 0.83
IGL01700:Myh1 APN 11 67211412 missense probably damaging 1.00
IGL01739:Myh1 APN 11 67214528 missense probably damaging 0.99
IGL01759:Myh1 APN 11 67219906 missense probably damaging 1.00
IGL01922:Myh1 APN 11 67210466 critical splice donor site probably null
IGL01952:Myh1 APN 11 67220392 splice site probably null
IGL02007:Myh1 APN 11 67220556 missense probably benign 0.03
IGL02028:Myh1 APN 11 67210615 missense probably damaging 1.00
IGL02245:Myh1 APN 11 67211487 missense possibly damaging 0.58
IGL02628:Myh1 APN 11 67206262 unclassified probably benign
IGL02942:Myh1 APN 11 67202482 missense probably damaging 1.00
IGL02967:Myh1 APN 11 67209070 missense possibly damaging 0.76
IGL03031:Myh1 APN 11 67206387 missense possibly damaging 0.47
IGL03187:Myh1 APN 11 67206525 missense possibly damaging 0.56
IGL03302:Myh1 APN 11 67211502 missense probably benign 0.01
convincing UTSW 11 67202539 missense probably damaging 1.00
muscle UTSW 11 67206048 nonsense probably null
Persuasive UTSW 11 67209064 missense possibly damaging 0.90
G1patch:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R0041:Myh1 UTSW 11 67209078 missense possibly damaging 0.88
R0079:Myh1 UTSW 11 67213411 missense probably damaging 1.00
R0081:Myh1 UTSW 11 67215857 missense probably benign
R0317:Myh1 UTSW 11 67217512 missense probably damaging 1.00
R0465:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R0528:Myh1 UTSW 11 67220619 missense probably damaging 1.00
R0731:Myh1 UTSW 11 67202533 missense probably damaging 0.98
R0964:Myh1 UTSW 11 67205925 missense probably benign
R0964:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R1427:Myh1 UTSW 11 67219747 missense probably damaging 0.99
R1429:Myh1 UTSW 11 67217910 missense possibly damaging 0.78
R1481:Myh1 UTSW 11 67205499 unclassified probably benign
R1562:Myh1 UTSW 11 67211370 missense probably benign 0.04
R1727:Myh1 UTSW 11 67210466 critical splice donor site probably benign
R1796:Myh1 UTSW 11 67224357 missense probably benign 0.00
R1808:Myh1 UTSW 11 67211474 nonsense probably null
R1836:Myh1 UTSW 11 67204822 missense probably damaging 0.98
R1848:Myh1 UTSW 11 67213630 missense probably benign 0.10
R1851:Myh1 UTSW 11 67204398 missense probably damaging 1.00
R1925:Myh1 UTSW 11 67211170 missense probably benign 0.01
R1967:Myh1 UTSW 11 67213447 missense probably benign 0.08
R1999:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2067:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2111:Myh1 UTSW 11 67214620 missense possibly damaging 0.83
R2150:Myh1 UTSW 11 67222408 missense probably benign 0.04
R2189:Myh1 UTSW 11 67221604 missense probably damaging 1.00
R2352:Myh1 UTSW 11 67220537 missense probably benign 0.00
R2436:Myh1 UTSW 11 67213271 missense probably benign 0.04
R2483:Myh1 UTSW 11 67211226 missense probably benign
R2508:Myh1 UTSW 11 67213598 missense possibly damaging 0.61
R2509:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2511:Myh1 UTSW 11 67205597 missense probably benign 0.01
R2908:Myh1 UTSW 11 67220696 nonsense probably null
R2966:Myh1 UTSW 11 67214584 missense probably damaging 1.00
R3829:Myh1 UTSW 11 67205597 missense probably benign 0.01
R4106:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4108:Myh1 UTSW 11 67211577 missense probably benign 0.33
R4457:Myh1 UTSW 11 67220615 missense probably benign 0.42
R4629:Myh1 UTSW 11 67209293 missense probably benign 0.01
R4981:Myh1 UTSW 11 67224474 utr 3 prime probably benign
R5032:Myh1 UTSW 11 67206048 nonsense probably null
R5239:Myh1 UTSW 11 67215225 missense probably benign 0.19
R5241:Myh1 UTSW 11 67204449 missense probably benign
R5303:Myh1 UTSW 11 67202017 missense probably benign 0.09
R5666:Myh1 UTSW 11 67221352 missense probably benign 0.30
R5717:Myh1 UTSW 11 67208956 missense probably benign
R5761:Myh1 UTSW 11 67219252 missense probably damaging 0.98
R5870:Myh1 UTSW 11 67201979 missense possibly damaging 0.70
R6077:Myh1 UTSW 11 67211447 missense probably damaging 1.00
R6089:Myh1 UTSW 11 67202167 splice site probably null
R6089:Myh1 UTSW 11 67220787 splice site probably null
R6197:Myh1 UTSW 11 67220967 missense probably benign 0.01
R6460:Myh1 UTSW 11 67221376 missense probably benign
R6627:Myh1 UTSW 11 67215009 missense probably damaging 1.00
R6634:Myh1 UTSW 11 67209064 missense possibly damaging 0.90
R6725:Myh1 UTSW 11 67201893 missense probably damaging 1.00
R6784:Myh1 UTSW 11 67214570 missense probably damaging 0.99
R6866:Myh1 UTSW 11 67224393 missense probably damaging 0.99
R6997:Myh1 UTSW 11 67220637 missense possibly damaging 0.94
R7028:Myh1 UTSW 11 67220421 missense possibly damaging 0.64
R7133:Myh1 UTSW 11 67202586 missense probably benign
R7185:Myh1 UTSW 11 67207459 missense probably damaging 1.00
R7194:Myh1 UTSW 11 67211357 missense probably benign
R7283:Myh1 UTSW 11 67201844 critical splice acceptor site probably null
R7336:Myh1 UTSW 11 67220609 missense probably benign 0.00
R7348:Myh1 UTSW 11 67202539 missense probably damaging 1.00
R7369:Myh1 UTSW 11 67220698 missense probably damaging 1.00
R7375:Myh1 UTSW 11 67210428 missense probably damaging 1.00
R7384:Myh1 UTSW 11 67224375 missense possibly damaging 0.46
R7387:Myh1 UTSW 11 67208889 missense probably benign 0.14
R7424:Myh1 UTSW 11 67213663 missense probably damaging 1.00
R7430:Myh1 UTSW 11 67205567 nonsense probably null
R7443:Myh1 UTSW 11 67220505 missense probably benign
R7447:Myh1 UTSW 11 67219180 missense probably benign 0.01
R7509:Myh1 UTSW 11 67210461 missense probably benign 0.40
R7583:Myh1 UTSW 11 67220913 missense probably benign 0.00
R7611:Myh1 UTSW 11 67210417 missense possibly damaging 0.50
R7617:Myh1 UTSW 11 67215875 missense possibly damaging 0.94
R7727:Myh1 UTSW 11 67215922 missense probably benign 0.00
R8029:Myh1 UTSW 11 67211240 critical splice donor site probably null
R8042:Myh1 UTSW 11 67206603 missense probably damaging 1.00
R8060:Myh1 UTSW 11 67215251 missense probably benign
R8080:Myh1 UTSW 11 67211402 missense probably benign 0.10
R8117:Myh1 UTSW 11 67222205 missense probably damaging 1.00
R8171:Myh1 UTSW 11 67202572 missense probably damaging 1.00
R8183:Myh1 UTSW 11 67202006 missense possibly damaging 0.50
R8397:Myh1 UTSW 11 67221639 missense probably damaging 0.97
R8545:Myh1 UTSW 11 67202201 missense probably benign 0.00
R8807:Myh1 UTSW 11 67220528 missense probably benign 0.02
R8812:Myh1 UTSW 11 67209141 missense probably benign 0.00
R8855:Myh1 UTSW 11 67211421 missense probably damaging 1.00
R8906:Myh1 UTSW 11 67205913 missense probably benign 0.02
R8959:Myh1 UTSW 11 67211502 missense probably benign
R8992:Myh1 UTSW 11 67205781 missense probably benign
R9140:Myh1 UTSW 11 67209263 missense probably benign 0.04
R9293:Myh1 UTSW 11 67209103 missense probably benign 0.25
R9366:Myh1 UTSW 11 67219288 missense probably damaging 1.00
R9371:Myh1 UTSW 11 67219805 critical splice donor site probably null
R9378:Myh1 UTSW 11 67202433 missense probably damaging 0.99
X0062:Myh1 UTSW 11 67207541 missense probably damaging 0.99
Z1177:Myh1 UTSW 11 67206318 missense probably damaging 1.00
Z1187:Myh1 UTSW 11 67204446 missense probably benign
Z1188:Myh1 UTSW 11 67204446 missense probably benign
Z1190:Myh1 UTSW 11 67204446 missense probably benign
Z1191:Myh1 UTSW 11 67204446 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCATCTGGCTGGAGAAAG -3'
(R):5'- CTGGATTTCCATCTCGTTCAGG -3'

Sequencing Primer
(F):5'- GGTGCATAGCTTCGACAATTATGC -3'
(R):5'- GGATTTCCATCTCGTTCAGGTCTCC -3'
Posted On 2018-09-12