Incidental Mutation 'R6813:Arfgap3'
ID533979
Institutional Source Beutler Lab
Gene Symbol Arfgap3
Ensembl Gene ENSMUSG00000054277
Gene NameADP-ribosylation factor GTPase activating protein 3
Synonyms1810004P07Rik, 0610009H19Rik, 1810035F16Rik, 9130416J18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R6813 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location83299739-83350247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83330593 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 164 (M164K)
Ref Sequence ENSEMBL: ENSMUSP00000154712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067215] [ENSMUST00000226124]
Predicted Effect probably benign
Transcript: ENSMUST00000067215
AA Change: M164K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064893
Gene: ENSMUSG00000054277
AA Change: M164K

DomainStartEndE-ValueType
ArfGap 10 126 7.18e-44 SMART
Blast:ArfGap 160 200 2e-6 BLAST
low complexity region 220 237 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
low complexity region 459 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226124
AA Change: M164K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase-activating protein (GAP) that associates with the Golgi apparatus and regulates the early secretory pathway of proteins. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1 (ARF1)-bound GTP, which is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is a prerequisite for the fusion of these vesicles with target compartments. The activity of this protein is sensitive to phospholipids. Multiple transcript variants encoding different isoforms have been found for this gene. This gene was originally known as ARFGAP1, but that is now the name of a related but different gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phka2 G A X: 160,533,048 V230I probably damaging Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Arfgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Arfgap3 APN 15 83322589 missense probably benign 0.04
IGL01306:Arfgap3 APN 15 83313509 missense possibly damaging 0.78
IGL01960:Arfgap3 APN 15 83313557 missense probably benign 0.04
IGL03029:Arfgap3 APN 15 83322650 missense probably damaging 1.00
IGL03036:Arfgap3 APN 15 83306926 missense possibly damaging 0.91
IGL03328:Arfgap3 APN 15 83343081 missense probably damaging 1.00
ANU23:Arfgap3 UTSW 15 83313509 missense possibly damaging 0.78
R0103:Arfgap3 UTSW 15 83322721 splice site probably benign
R0103:Arfgap3 UTSW 15 83322721 splice site probably benign
R0125:Arfgap3 UTSW 15 83343139 missense probably benign 0.01
R0243:Arfgap3 UTSW 15 83330513 splice site probably benign
R0551:Arfgap3 UTSW 15 83343137 missense probably damaging 1.00
R0557:Arfgap3 UTSW 15 83303185 missense probably damaging 1.00
R0638:Arfgap3 UTSW 15 83308188 splice site probably null
R1115:Arfgap3 UTSW 15 83330540 missense probably benign 0.00
R1459:Arfgap3 UTSW 15 83306937 missense probably benign 0.15
R1576:Arfgap3 UTSW 15 83313563 missense possibly damaging 0.94
R1776:Arfgap3 UTSW 15 83343139 missense probably benign 0.01
R1826:Arfgap3 UTSW 15 83303102 critical splice donor site probably null
R2057:Arfgap3 UTSW 15 83310300 missense probably benign
R2084:Arfgap3 UTSW 15 83334566 missense probably damaging 0.96
R3407:Arfgap3 UTSW 15 83322607 missense probably benign 0.00
R4072:Arfgap3 UTSW 15 83303129 missense probably damaging 1.00
R4074:Arfgap3 UTSW 15 83303129 missense probably damaging 1.00
R4206:Arfgap3 UTSW 15 83322668 missense probably benign
R4449:Arfgap3 UTSW 15 83334558 missense probably damaging 1.00
R5004:Arfgap3 UTSW 15 83310296 missense possibly damaging 0.87
R5193:Arfgap3 UTSW 15 83332697 missense probably benign 0.01
R5364:Arfgap3 UTSW 15 83314361 missense probably damaging 1.00
R6142:Arfgap3 UTSW 15 83350127 missense probably damaging 1.00
R7154:Arfgap3 UTSW 15 83336704 missense probably damaging 1.00
R7422:Arfgap3 UTSW 15 83306949 missense probably damaging 0.97
R7582:Arfgap3 UTSW 15 83303101 missense possibly damaging 0.77
R7714:Arfgap3 UTSW 15 83308151 missense probably benign 0.34
Z1177:Arfgap3 UTSW 15 83332688 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCATGGGCTAACACAACAG -3'
(R):5'- CAATTCCAAGATTTATTCCCTAGAAGG -3'

Sequencing Primer
(F):5'- TGGGCTAACACAACAGGTTTC -3'
(R):5'- TACCAAGTTCTAGGCCAGTCTGAG -3'
Posted On2018-09-12