Mutagenetix > Incidental Mutations

Incidental Mutation 'R6813:Arfgap3'

533979

Institutional Source

Beutler Lab

Gene Symbol

Arfgap3

Ensembl Gene

ENSMUSG00000054277

Gene Name

ADP-ribosylation factor GTPase activating protein 3

Synonyms

1810004P07Rik, 0610009H19Rik, 1810035F16Rik, 9130416J18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R6813 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83299739-83350247 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 83330593 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 164 (M164K)

Ref Sequence

ENSEMBL: ENSMUSP00000154712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067215] [ENSMUST00000226124]

Predicted Effect

probably benign
Transcript: ENSMUST00000067215
AA Change: M164K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000064893
Gene: ENSMUSG00000054277
AA Change: M164K

Domain	Start	End	E-Value	Type
ArfGap	10	126	7.18e-44	SMART
Blast:ArfGap	160	200	2e-6	BLAST
low complexity region	220	237	N/A	INTRINSIC
low complexity region	348	362	N/A	INTRINSIC
low complexity region	459	466	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000226124
AA Change: M164K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.9%
20x: 96.9%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase-activating protein (GAP) that associates with the Golgi apparatus and regulates the early secretory pathway of proteins. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1 (ARF1)-bound GTP, which is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is a prerequisite for the fusion of these vesicles with target compartments. The activity of this protein is sensitive to phospholipids. Multiple transcript variants encoding different isoforms have been found for this gene. This gene was originally known as ARFGAP1, but that is now the name of a related but different gene. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,229,282	N2337K	probably benign	Het
Adgrb2	C	A	4: 130,009,491	Q603K	probably damaging	Het
Adgrf3	A	G	5: 30,197,521	F503S	probably damaging	Het
Asb13	G	T	13: 3,645,029	V166F	probably damaging	Het
Atm	T	G	9: 53,497,235	R1103S	probably benign	Het
Atxn7l1	T	C	12: 33,367,124	I626T	probably damaging	Het
Brsk2	A	G	7: 142,002,477	I649V	probably benign	Het
Ccdc25	T	A	14: 65,856,433	M85K	probably benign	Het
Cdc42bpb	A	G	12: 111,327,615	V231A	probably damaging	Het
Clstn3	T	A	6: 124,436,935	M767L	probably benign	Het
Col6a6	C	T	9: 105,783,941	R323K	probably benign	Het
Creld1	A	G	6: 113,489,569	Y199C	probably damaging	Het
Csf1r	T	A	18: 61,112,734	D254E	probably benign	Het
Dab2ip	C	T	2: 35,730,473	Q1118*	probably null	Het
Dcun1d4	C	A	5: 73,520,957	S98R	possibly damaging	Het
Disp3	G	A	4: 148,259,930	P505L	probably benign	Het
Dlec1	A	T	9: 119,112,102	Q240L	probably benign	Het
Edil3	T	A	13: 89,289,456	I392N	probably damaging	Het
Epha10	T	A	4: 124,902,693	S398R		Het
Ephb1	A	G	9: 102,010,048	I464T	possibly damaging	Het
Eps15	T	A	4: 109,280,402		probably null	Het
Fam111a	T	A	19: 12,587,342	C152S	probably damaging	Het
Flt3	T	C	5: 147,354,843	E599G	probably damaging	Het
Frmd3	T	C	4: 74,159,245	S259P	probably benign	Het
Gm15922	T	C	7: 3,736,003	H535R	probably benign	Het
Gm30302	T	A	13: 49,787,396	R279S	probably benign	Het
Hsfy2	A	G	1: 56,636,302	Y359H	possibly damaging	Het
Ifih1	C	T	2: 62,645,693	V80M	possibly damaging	Het
Il12rb2	A	C	6: 67,292,374	D818E	probably damaging	Het
Il4i1	A	G	7: 44,839,812	T334A	probably benign	Het
Irs2	G	A	8: 11,004,659	Q1258*	probably null	Het
Lsm1	T	G	8: 25,793,693	H44Q	probably benign	Het
Mgam	A	T	6: 40,750,165	M1257L	probably damaging	Het
Myc	T	C	15: 61,988,152	S225P	probably damaging	Het
Myh1	T	C	11: 67,220,460	V1575A	probably benign	Het
Myo9b	A	G	8: 71,323,305	D380G	probably damaging	Het
Ncoa7	T	A	10: 30,696,192	D157V	probably damaging	Het
Olfr314	G	T	11: 58,786,646	Q137H	probably benign	Het
Olfr828	G	A	9: 18,815,892	T134M	probably benign	Het
Olfr877	A	C	9: 37,855,514	E232A	possibly damaging	Het
Olfr883	T	C	9: 38,025,833	V9A	probably damaging	Het
Olfr980	T	A	9: 40,006,457	H164L	probably benign	Het
Pccb	A	G	9: 101,023,215	V117A	probably damaging	Het
Pdp2	C	T	8: 104,594,499	H327Y	probably damaging	Het
Pdzph1	G	T	17: 58,974,436	Q284K	probably benign	Het
Phka2	G	A	X: 160,533,048	V230I	probably damaging	Het
Phldb1	A	T	9: 44,699,568	S751R	probably damaging	Het
Ppp1r1b	T	A	11: 98,349,176		probably null	Het
Ppp1r3a	A	G	6: 14,719,571	V448A	probably benign	Het
Pvrig	A	T	5: 138,342,050	T28S	probably benign	Het
Rasgrf1	G	A	9: 90,010,484		probably null	Het
Scnn1g	T	C	7: 121,740,353	L125S	probably damaging	Het
Slc30a7	A	T	3: 115,981,811	D221E	probably benign	Het
Tmem30c	A	G	16: 57,281,259		probably null	Het
Tmem33	T	C	5: 67,264,459		probably null	Het
Ttc29	A	T	8: 78,333,620	T390S	probably benign	Het
Vamp5	G	A	6: 72,380,441		probably benign	Het
Vmn2r81	T	A	10: 79,268,605	F354Y	probably benign	Het
Vmn2r96	A	G	17: 18,581,854	H119R	probably benign	Het
Wdr3	G	A	3: 100,138,725	R931*	probably null	Het
Wdr78	T	C	4: 103,048,326	K753E	probably benign	Het
Wtap	A	T	17: 12,967,510	N383K	probably damaging	Het
Zfp808	T	C	13: 62,173,035	Y693H	probably damaging	Het

Other mutations in Arfgap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00908:Arfgap3	APN	15	83322589	missense	probably benign	0.04
IGL01306:Arfgap3	APN	15	83313509	missense	possibly damaging	0.78
IGL01960:Arfgap3	APN	15	83313557	missense	probably benign	0.04
IGL03029:Arfgap3	APN	15	83322650	missense	probably damaging	1.00
IGL03036:Arfgap3	APN	15	83306926	missense	possibly damaging	0.91
IGL03328:Arfgap3	APN	15	83343081	missense	probably damaging	1.00
ANU23:Arfgap3	UTSW	15	83313509	missense	possibly damaging	0.78
R0103:Arfgap3	UTSW	15	83322721	splice site	probably benign
R0103:Arfgap3	UTSW	15	83322721	splice site	probably benign
R0125:Arfgap3	UTSW	15	83343139	missense	probably benign	0.01
R0243:Arfgap3	UTSW	15	83330513	splice site	probably benign
R0551:Arfgap3	UTSW	15	83343137	missense	probably damaging	1.00
R0557:Arfgap3	UTSW	15	83303185	missense	probably damaging	1.00
R0638:Arfgap3	UTSW	15	83308188	splice site	probably null
R1115:Arfgap3	UTSW	15	83330540	missense	probably benign	0.00
R1459:Arfgap3	UTSW	15	83306937	missense	probably benign	0.15
R1576:Arfgap3	UTSW	15	83313563	missense	possibly damaging	0.94
R1776:Arfgap3	UTSW	15	83343139	missense	probably benign	0.01
R1826:Arfgap3	UTSW	15	83303102	critical splice donor site	probably null
R2057:Arfgap3	UTSW	15	83310300	missense	probably benign
R2084:Arfgap3	UTSW	15	83334566	missense	probably damaging	0.96
R3407:Arfgap3	UTSW	15	83322607	missense	probably benign	0.00
R4072:Arfgap3	UTSW	15	83303129	missense	probably damaging	1.00
R4074:Arfgap3	UTSW	15	83303129	missense	probably damaging	1.00
R4206:Arfgap3	UTSW	15	83322668	missense	probably benign
R4449:Arfgap3	UTSW	15	83334558	missense	probably damaging	1.00
R5004:Arfgap3	UTSW	15	83310296	missense	possibly damaging	0.87
R5193:Arfgap3	UTSW	15	83332697	missense	probably benign	0.01
R5364:Arfgap3	UTSW	15	83314361	missense	probably damaging	1.00
R6142:Arfgap3	UTSW	15	83350127	missense	probably damaging	1.00
R7154:Arfgap3	UTSW	15	83336704	missense	probably damaging	1.00
R7422:Arfgap3	UTSW	15	83306949	missense	probably damaging	0.97
R7582:Arfgap3	UTSW	15	83303101	missense	possibly damaging	0.77
R7714:Arfgap3	UTSW	15	83308151	missense	probably benign	0.34
R8269:Arfgap3	UTSW	15	83310341	missense	probably benign	0.01
Z1177:Arfgap3	UTSW	15	83332688	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCATGGGCTAACACAACAG -3'
(R):5'- CAATTCCAAGATTTATTCCCTAGAAGG -3'

Sequencing Primer
(F):5'- TGGGCTAACACAACAGGTTTC -3'
(R):5'- TACCAAGTTCTAGGCCAGTCTGAG -3'

Posted On

2018-09-12