Incidental Mutation 'R6813:Pdzph1'
ID 533983
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 044925-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R6813 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 59281431 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 284 (Q284K)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect probably benign
Transcript: ENSMUST00000025064
AA Change: Q284K

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: Q284K

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb2 C A 4: 129,903,284 (GRCm39) Q603K probably damaging Het
Adgrf3 A G 5: 30,402,519 (GRCm39) F503S probably damaging Het
Arfgap3 A T 15: 83,214,794 (GRCm39) M164K probably benign Het
Asb13 G T 13: 3,695,029 (GRCm39) V166F probably damaging Het
Atm T G 9: 53,408,535 (GRCm39) R1103S probably benign Het
Atxn7l1 T C 12: 33,417,123 (GRCm39) I626T probably damaging Het
Brsk2 A G 7: 141,556,214 (GRCm39) I649V probably benign Het
Ccdc25 T A 14: 66,093,882 (GRCm39) M85K probably benign Het
Cdc42bpb A G 12: 111,294,049 (GRCm39) V231A probably damaging Het
Clstn3 T A 6: 124,413,894 (GRCm39) M767L probably benign Het
Col6a6 C T 9: 105,661,140 (GRCm39) R323K probably benign Het
Cplane1 T A 15: 8,258,766 (GRCm39) N2337K probably benign Het
Creld1 A G 6: 113,466,530 (GRCm39) Y199C probably damaging Het
Csf1r T A 18: 61,245,806 (GRCm39) D254E probably benign Het
Dab2ip C T 2: 35,620,485 (GRCm39) Q1118* probably null Het
Dcun1d4 C A 5: 73,678,300 (GRCm39) S98R possibly damaging Het
Disp3 G A 4: 148,344,387 (GRCm39) P505L probably benign Het
Dlec1 A T 9: 118,941,170 (GRCm39) Q240L probably benign Het
Dnai4 T C 4: 102,905,523 (GRCm39) K753E probably benign Het
Edil3 T A 13: 89,437,575 (GRCm39) I392N probably damaging Het
Epha10 T A 4: 124,796,486 (GRCm39) S398R Het
Ephb1 A G 9: 101,887,247 (GRCm39) I464T possibly damaging Het
Eps15 T A 4: 109,137,599 (GRCm39) probably null Het
Fam111a T A 19: 12,564,706 (GRCm39) C152S probably damaging Het
Flt3 T C 5: 147,291,653 (GRCm39) E599G probably damaging Het
Frmd3 T C 4: 74,077,482 (GRCm39) S259P probably benign Het
Hsfy2 A G 1: 56,675,461 (GRCm39) Y359H possibly damaging Het
Ifih1 C T 2: 62,476,037 (GRCm39) V80M possibly damaging Het
Il12rb2 A C 6: 67,269,358 (GRCm39) D818E probably damaging Het
Il4i1 A G 7: 44,489,236 (GRCm39) T334A probably benign Het
Irs2 G A 8: 11,054,659 (GRCm39) Q1258* probably null Het
Lsm1 T G 8: 26,283,721 (GRCm39) H44Q probably benign Het
Mgam A T 6: 40,727,099 (GRCm39) M1257L probably damaging Het
Myc T C 15: 61,860,001 (GRCm39) S225P probably damaging Het
Myh1 T C 11: 67,111,286 (GRCm39) V1575A probably benign Het
Myo9b A G 8: 71,775,949 (GRCm39) D380G probably damaging Het
Ncoa7 T A 10: 30,572,188 (GRCm39) D157V probably damaging Het
Or10g9b T A 9: 39,917,753 (GRCm39) H164L probably benign Het
Or2t44 G T 11: 58,677,472 (GRCm39) Q137H probably benign Het
Or7g16 G A 9: 18,727,188 (GRCm39) T134M probably benign Het
Or8b36 T C 9: 37,937,129 (GRCm39) V9A probably damaging Het
Or8b9 A C 9: 37,766,810 (GRCm39) E232A possibly damaging Het
Pccb A G 9: 100,905,268 (GRCm39) V117A probably damaging Het
Pdp2 C T 8: 105,321,131 (GRCm39) H327Y probably damaging Het
Phka2 G A X: 159,316,044 (GRCm39) V230I probably damaging Het
Phldb1 A T 9: 44,610,865 (GRCm39) S751R probably damaging Het
Pira1 T C 7: 3,739,002 (GRCm39) H535R probably benign Het
Ppp1r1b T A 11: 98,240,002 (GRCm39) probably null Het
Ppp1r3a A G 6: 14,719,570 (GRCm39) V448A probably benign Het
Pvrig-ps A T 5: 138,340,312 (GRCm39) T28S probably benign Het
Rasgrf1 G A 9: 89,892,537 (GRCm39) probably null Het
Scnn1g T C 7: 121,339,576 (GRCm39) L125S probably damaging Het
Slc30a7 A T 3: 115,775,460 (GRCm39) D221E probably benign Het
Spata31e1 T A 13: 49,940,872 (GRCm39) R279S probably benign Het
Tmem30c A G 16: 57,101,622 (GRCm39) probably null Het
Tmem33 T C 5: 67,421,802 (GRCm39) probably null Het
Ttc29 A T 8: 79,060,249 (GRCm39) T390S probably benign Het
Vamp5 G A 6: 72,357,424 (GRCm39) probably benign Het
Vmn2r81 T A 10: 79,104,439 (GRCm39) F354Y probably benign Het
Vmn2r96 A G 17: 18,802,116 (GRCm39) H119R probably benign Het
Wdr3 G A 3: 100,046,041 (GRCm39) R931* probably null Het
Wtap A T 17: 13,186,397 (GRCm39) N383K probably damaging Het
Zfp808 T C 13: 62,320,849 (GRCm39) Y693H probably damaging Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGACTCTCCCTCTTCAG -3'
(R):5'- GGTTTCTAGAAGTGAGGTACCTTC -3'

Sequencing Primer
(F):5'- GAGTCATCTGGGGCTGAAGGC -3'
(R):5'- TGAGGTACCTTCAGTGAACATAAGC -3'
Posted On 2018-09-12