Incidental Mutation 'R6813:Phka2'
ID 533986
Institutional Source Beutler Lab
Gene Symbol Phka2
Ensembl Gene ENSMUSG00000031295
Gene Name phosphorylase kinase alpha 2
Synonyms 6330505C01Rik, Phk, k
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock # R6813 (G1)
Quality Score 221.999
Status Validated
Chromosome X
Chromosomal Location 160502166-160598878 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 160533048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 230 (V230I)
Ref Sequence ENSEMBL: ENSMUSP00000107999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033652] [ENSMUST00000112376] [ENSMUST00000112377] [ENSMUST00000112380]
AlphaFold Q8BWJ3
Predicted Effect probably damaging
Transcript: ENSMUST00000033652
AA Change: V230I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033652
Gene: ENSMUSG00000031295
AA Change: V230I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 919 9.2e-200 PFAM
low complexity region 1039 1055 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112376
AA Change: V230I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107995
Gene: ENSMUSG00000031295
AA Change: V230I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 521 1.5e-158 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112377
AA Change: V230I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107996
Gene: ENSMUSG00000031295
AA Change: V230I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 919 9.2e-200 PFAM
low complexity region 1039 1055 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112380
AA Change: V230I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107999
Gene: ENSMUSG00000031295
AA Change: V230I

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 919 4.5e-197 PFAM
low complexity region 1039 1055 N/A INTRINSIC
Meta Mutation Damage Score 0.2173 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.9%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, which are encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9A, also known as X-linked liver glycogenosis. Alternatively spliced transcript variants have been reported, but the full-length nature of these variants has not been determined.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,229,282 N2337K probably benign Het
Adgrb2 C A 4: 130,009,491 Q603K probably damaging Het
Adgrf3 A G 5: 30,197,521 F503S probably damaging Het
Arfgap3 A T 15: 83,330,593 M164K probably benign Het
Asb13 G T 13: 3,645,029 V166F probably damaging Het
Atm T G 9: 53,497,235 R1103S probably benign Het
Atxn7l1 T C 12: 33,367,124 I626T probably damaging Het
Brsk2 A G 7: 142,002,477 I649V probably benign Het
Ccdc25 T A 14: 65,856,433 M85K probably benign Het
Cdc42bpb A G 12: 111,327,615 V231A probably damaging Het
Clstn3 T A 6: 124,436,935 M767L probably benign Het
Col6a6 C T 9: 105,783,941 R323K probably benign Het
Creld1 A G 6: 113,489,569 Y199C probably damaging Het
Csf1r T A 18: 61,112,734 D254E probably benign Het
Dab2ip C T 2: 35,730,473 Q1118* probably null Het
Dcun1d4 C A 5: 73,520,957 S98R possibly damaging Het
Disp3 G A 4: 148,259,930 P505L probably benign Het
Dlec1 A T 9: 119,112,102 Q240L probably benign Het
Edil3 T A 13: 89,289,456 I392N probably damaging Het
Epha10 T A 4: 124,902,693 S398R Het
Ephb1 A G 9: 102,010,048 I464T possibly damaging Het
Eps15 T A 4: 109,280,402 probably null Het
Fam111a T A 19: 12,587,342 C152S probably damaging Het
Flt3 T C 5: 147,354,843 E599G probably damaging Het
Frmd3 T C 4: 74,159,245 S259P probably benign Het
Gm15922 T C 7: 3,736,003 H535R probably benign Het
Gm30302 T A 13: 49,787,396 R279S probably benign Het
Hsfy2 A G 1: 56,636,302 Y359H possibly damaging Het
Ifih1 C T 2: 62,645,693 V80M possibly damaging Het
Il12rb2 A C 6: 67,292,374 D818E probably damaging Het
Il4i1 A G 7: 44,839,812 T334A probably benign Het
Irs2 G A 8: 11,004,659 Q1258* probably null Het
Lsm1 T G 8: 25,793,693 H44Q probably benign Het
Mgam A T 6: 40,750,165 M1257L probably damaging Het
Myc T C 15: 61,988,152 S225P probably damaging Het
Myh1 T C 11: 67,220,460 V1575A probably benign Het
Myo9b A G 8: 71,323,305 D380G probably damaging Het
Ncoa7 T A 10: 30,696,192 D157V probably damaging Het
Olfr314 G T 11: 58,786,646 Q137H probably benign Het
Olfr828 G A 9: 18,815,892 T134M probably benign Het
Olfr877 A C 9: 37,855,514 E232A possibly damaging Het
Olfr883 T C 9: 38,025,833 V9A probably damaging Het
Olfr980 T A 9: 40,006,457 H164L probably benign Het
Pccb A G 9: 101,023,215 V117A probably damaging Het
Pdp2 C T 8: 104,594,499 H327Y probably damaging Het
Pdzph1 G T 17: 58,974,436 Q284K probably benign Het
Phldb1 A T 9: 44,699,568 S751R probably damaging Het
Ppp1r1b T A 11: 98,349,176 probably null Het
Ppp1r3a A G 6: 14,719,571 V448A probably benign Het
Pvrig A T 5: 138,342,050 T28S probably benign Het
Rasgrf1 G A 9: 90,010,484 probably null Het
Scnn1g T C 7: 121,740,353 L125S probably damaging Het
Slc30a7 A T 3: 115,981,811 D221E probably benign Het
Tmem30c A G 16: 57,281,259 probably null Het
Tmem33 T C 5: 67,264,459 probably null Het
Ttc29 A T 8: 78,333,620 T390S probably benign Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r81 T A 10: 79,268,605 F354Y probably benign Het
Vmn2r96 A G 17: 18,581,854 H119R probably benign Het
Wdr3 G A 3: 100,138,725 R931* probably null Het
Wdr78 T C 4: 103,048,326 K753E probably benign Het
Wtap A T 17: 12,967,510 N383K probably damaging Het
Zfp808 T C 13: 62,173,035 Y693H probably damaging Het
Other mutations in Phka2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Phka2 APN X 160564213 missense possibly damaging 0.68
IGL02179:Phka2 APN X 160554380 critical splice donor site probably null
IGL03034:Phka2 APN X 160577550 nonsense probably null
R1996:Phka2 UTSW X 160541415 missense probably benign 0.27
R2054:Phka2 UTSW X 160554327 missense probably damaging 1.00
R2237:Phka2 UTSW X 160541412 missense probably damaging 1.00
R2238:Phka2 UTSW X 160541412 missense probably damaging 1.00
R2239:Phka2 UTSW X 160541412 missense probably damaging 1.00
R3622:Phka2 UTSW X 160544295 nonsense probably null
R3623:Phka2 UTSW X 160544295 nonsense probably null
R3701:Phka2 UTSW X 160533049 missense possibly damaging 0.95
R5735:Phka2 UTSW X 160559866 frame shift probably null
R5736:Phka2 UTSW X 160559866 frame shift probably null
R5737:Phka2 UTSW X 160559866 frame shift probably null
R5738:Phka2 UTSW X 160559866 frame shift probably null
R6812:Phka2 UTSW X 160533048 missense probably damaging 0.99
R6957:Phka2 UTSW X 160533048 missense probably damaging 0.99
R6960:Phka2 UTSW X 160533048 missense probably damaging 0.99
X0066:Phka2 UTSW X 160549272 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGACATTCTTCATTGCCATTAGGAG -3'
(R):5'- ATGCTTTGGCTGTTAGCTCC -3'

Sequencing Primer
(F):5'- CTTCATTGCCATTAGGAGAAACATG -3'
(R):5'- GACGAGTTGCCCAGGTTCATTTAC -3'
Posted On 2018-09-12