Incidental Mutation 'R6814:D2hgdh'
ID533987
Institutional Source Beutler Lab
Gene Symbol D2hgdh
Ensembl Gene ENSMUSG00000073609
Gene NameD-2-hydroxyglutarate dehydrogenase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R6814 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93824909-93852348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93835303 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 270 (T270N)
Ref Sequence ENSEMBL: ENSMUSP00000108502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097633] [ENSMUST00000112881] [ENSMUST00000188532] [ENSMUST00000189154]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097633
AA Change: T248N

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095235
Gene: ENSMUSG00000073609
AA Change: T248N

DomainStartEndE-ValueType
Pfam:FAD_binding_4 114 253 2.7e-35 PFAM
Pfam:FAD-oxidase_C 289 530 7.3e-58 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112881
AA Change: T270N

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108502
Gene: ENSMUSG00000073609
AA Change: T270N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:FAD_binding_4 136 275 7e-36 PFAM
Pfam:FAD-oxidase_C 311 552 4.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186783
Predicted Effect probably benign
Transcript: ENSMUST00000188532
Predicted Effect probably benign
Transcript: ENSMUST00000189154
SMART Domains Protein: ENSMUSP00000140506
Gene: ENSMUSG00000073609

DomainStartEndE-ValueType
Pfam:FAD_binding_4 114 179 3.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes D-2hydroxyglutarate dehydrogenase, a mitochondrial enzyme belonging to the FAD-binding oxidoreductase/transferase type 4 family. This enzyme, which is most active in liver and kidney but also active in heart and brain, converts D-2-hydroxyglutarate to 2-ketoglutarate. Mutations in this gene are present in D-2-hydroxyglutaric aciduria, a rare recessive neurometabolic disorder causing developmental delay, epilepsy, hypotonia, and dysmorphic features. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,180 V336I probably benign Het
Abca7 G A 10: 80,002,999 V669I probably damaging Het
Abcg3 T C 5: 104,935,994 T637A probably benign Het
Afap1l1 A T 18: 61,733,741 V749E probably benign Het
Arfgef3 A G 10: 18,595,019 L1666S probably damaging Het
Atp2b1 A G 10: 99,023,015 N284D possibly damaging Het
Ccdc24 T C 4: 117,869,926 T196A probably benign Het
Cdc20b G A 13: 113,083,975 G463S probably damaging Het
Ceacam5 A T 7: 17,752,287 R570* probably null Het
Cit G A 5: 115,884,963 C283Y probably damaging Het
Cpa5 A T 6: 30,614,054 Q65L probably benign Het
Cspg4 A G 9: 56,890,340 I1363V possibly damaging Het
Dnah8 G T 17: 30,762,679 L3058F probably damaging Het
Dnajb8 A G 6: 88,223,040 N186S probably damaging Het
Dock4 T C 12: 40,812,326 probably null Het
Ear6 A G 14: 51,854,428 Y144C probably damaging Het
Fam53a T C 5: 33,610,485 Y27C probably benign Het
Fgf2 A G 3: 37,404,711 K85E probably damaging Het
Fubp1 A T 3: 152,226,146 Q37L probably benign Het
Gabra2 G T 5: 71,094,539 P22T probably damaging Het
Gm10401 T C 5: 115,098,186 probably benign Het
Gm436 A T 4: 144,670,646 L172* probably null Het
Gm6657 T A 12: 78,197,367 D31E probably damaging Het
Iglv3 A G 16: 19,241,284 I98T probably damaging Het
Nlrp2 C T 7: 5,308,710 R922H probably benign Het
Nr1h4 T C 10: 89,454,745 T474A probably damaging Het
Pcdhb20 A C 18: 37,506,165 E581D probably benign Het
Pidd1 G T 7: 141,439,418 T750K probably benign Het
Pigq A T 17: 25,931,656 probably benign Het
Rab44 A G 17: 29,139,810 E324G probably benign Het
Slc17a2 T C 13: 23,822,389 I466T possibly damaging Het
Slc24a3 C T 2: 145,616,710 Q537* probably null Het
Slc7a10 T C 7: 35,195,264 V116A probably damaging Het
Taf15 T A 11: 83,499,089 N228K probably damaging Het
Tbx19 A T 1: 165,147,633 probably null Het
Tgoln1 A G 6: 72,615,555 V314A possibly damaging Het
Them4 A T 3: 94,324,371 I172F probably damaging Het
Tmc7 T A 7: 118,547,623 Y477F probably benign Het
Tmem132a A G 19: 10,863,305 L421P probably damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r11 T G 5: 109,047,110 R783S possibly damaging Het
Zfp180 G T 7: 24,105,881 C575F probably damaging Het
Zfp189 A T 4: 49,529,026 N43I probably damaging Het
Zfp36l2 A G 17: 84,186,093 probably benign Het
Zfp592 T C 7: 81,023,828 V180A probably benign Het
Zfp605 C T 5: 110,127,445 P143L probably benign Het
Zfp646 T C 7: 127,883,333 S1561P probably benign Het
Other mutations in D2hgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:D2hgdh APN 1 93829889 missense probably benign 0.06
IGL02506:D2hgdh APN 1 93829785 missense probably damaging 0.98
IGL02995:D2hgdh APN 1 93829836 missense probably damaging 1.00
PIT1430001:D2hgdh UTSW 1 93826279 unclassified probably benign
PIT4418001:D2hgdh UTSW 1 93838868 missense possibly damaging 0.90
R0069:D2hgdh UTSW 1 93835287 missense possibly damaging 0.93
R0080:D2hgdh UTSW 1 93826455 missense probably damaging 0.97
R0538:D2hgdh UTSW 1 93826377 missense probably damaging 0.97
R2267:D2hgdh UTSW 1 93835435 missense probably damaging 0.97
R2268:D2hgdh UTSW 1 93835435 missense probably damaging 0.97
R2269:D2hgdh UTSW 1 93835435 missense probably damaging 0.97
R4419:D2hgdh UTSW 1 93829813 missense probably damaging 1.00
R5322:D2hgdh UTSW 1 93829898 critical splice donor site probably null
R6018:D2hgdh UTSW 1 93826460 missense probably benign 0.03
R6264:D2hgdh UTSW 1 93826455 missense probably damaging 0.97
R6750:D2hgdh UTSW 1 93826407 missense probably benign 0.01
R7058:D2hgdh UTSW 1 93835374 missense probably damaging 1.00
R7473:D2hgdh UTSW 1 93838078 missense probably damaging 0.96
R7683:D2hgdh UTSW 1 93838965 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGACTCAATAGGGGTGGC -3'
(R):5'- TCACTCCGACATGTCCAGAG -3'

Sequencing Primer
(F):5'- CTCAATAGGGGTGGCACGGG -3'
(R):5'- TCTCCGATAGCTGGCTCAGAAG -3'
Posted On2018-09-12