Incidental Mutation 'R6814:Tbx19'
ID533988
Institutional Source Beutler Lab
Gene Symbol Tbx19
Ensembl Gene ENSMUSG00000026572
Gene NameT-box 19
SynonymsTpit, D1Ertd754e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R6814 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location165137855-165160773 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 165147633 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000027859]
Predicted Effect probably null
Transcript: ENSMUST00000027859
SMART Domains Protein: ENSMUSP00000027859
Gene: ENSMUSG00000026572

DomainStartEndE-ValueType
TBOX 38 221 1.26e-114 SMART
low complexity region 263 275 N/A INTRINSIC
Blast:TBOX 343 410 2e-18 BLAST
low complexity region 424 443 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161144
SMART Domains Protein: ENSMUSP00000123909
Gene: ENSMUSG00000026572

DomainStartEndE-ValueType
TBOX 1 156 4.56e-80 SMART
Blast:TBOX 215 282 5e-19 BLAST
low complexity region 296 315 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcription factors containing a characteristic T-box DNA-binding domain. The encoded protein promotes expression of the pro-opiomelanocortin (POMC) gene, which is important for the differentiation of cells in the pituitary gland. [provided by RefSeq, Mar 2013]
PHENOTYPE: The phenotype of homozygous null mice is similar to that of patients with early onset pituitary ACTH deficiency. They are characterized by fasting-induced hypoglycemia due to an impaired pituitary-adrenal axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,180 V336I probably benign Het
Abca7 G A 10: 80,002,999 V669I probably damaging Het
Abcg3 T C 5: 104,935,994 T637A probably benign Het
Afap1l1 A T 18: 61,733,741 V749E probably benign Het
Arfgef3 A G 10: 18,595,019 L1666S probably damaging Het
Atp2b1 A G 10: 99,023,015 N284D possibly damaging Het
Ccdc24 T C 4: 117,869,926 T196A probably benign Het
Cdc20b G A 13: 113,083,975 G463S probably damaging Het
Ceacam5 A T 7: 17,752,287 R570* probably null Het
Cit G A 5: 115,884,963 C283Y probably damaging Het
Cpa5 A T 6: 30,614,054 Q65L probably benign Het
Cspg4 A G 9: 56,890,340 I1363V possibly damaging Het
D2hgdh C A 1: 93,835,303 T270N possibly damaging Het
Dnah8 G T 17: 30,762,679 L3058F probably damaging Het
Dnajb8 A G 6: 88,223,040 N186S probably damaging Het
Dock4 T C 12: 40,812,326 probably null Het
Ear6 A G 14: 51,854,428 Y144C probably damaging Het
Fam53a T C 5: 33,610,485 Y27C probably benign Het
Fgf2 A G 3: 37,404,711 K85E probably damaging Het
Fubp1 A T 3: 152,226,146 Q37L probably benign Het
Gabra2 G T 5: 71,094,539 P22T probably damaging Het
Gm10401 T C 5: 115,098,186 probably benign Het
Gm436 A T 4: 144,670,646 L172* probably null Het
Gm6657 T A 12: 78,197,367 D31E probably damaging Het
Iglv3 A G 16: 19,241,284 I98T probably damaging Het
Nlrp2 C T 7: 5,308,710 R922H probably benign Het
Nr1h4 T C 10: 89,454,745 T474A probably damaging Het
Pcdhb20 A C 18: 37,506,165 E581D probably benign Het
Pidd1 G T 7: 141,439,418 T750K probably benign Het
Pigq A T 17: 25,931,656 probably benign Het
Rab44 A G 17: 29,139,810 E324G probably benign Het
Slc17a2 T C 13: 23,822,389 I466T possibly damaging Het
Slc24a3 C T 2: 145,616,710 Q537* probably null Het
Slc7a10 T C 7: 35,195,264 V116A probably damaging Het
Taf15 T A 11: 83,499,089 N228K probably damaging Het
Tgoln1 A G 6: 72,615,555 V314A possibly damaging Het
Them4 A T 3: 94,324,371 I172F probably damaging Het
Tmc7 T A 7: 118,547,623 Y477F probably benign Het
Tmem132a A G 19: 10,863,305 L421P probably damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r11 T G 5: 109,047,110 R783S possibly damaging Het
Zfp180 G T 7: 24,105,881 C575F probably damaging Het
Zfp189 A T 4: 49,529,026 N43I probably damaging Het
Zfp36l2 A G 17: 84,186,093 probably benign Het
Zfp592 T C 7: 81,023,828 V180A probably benign Het
Zfp605 C T 5: 110,127,445 P143L probably benign Het
Zfp646 T C 7: 127,883,333 S1561P probably benign Het
Other mutations in Tbx19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Tbx19 APN 1 165160399 missense probably benign 0.05
IGL00849:Tbx19 APN 1 165152040 missense probably benign 0.08
IGL01545:Tbx19 APN 1 165139156 missense possibly damaging 0.77
IGL01893:Tbx19 APN 1 165140198 missense possibly damaging 0.93
IGL02451:Tbx19 APN 1 165140171 missense probably benign 0.03
IGL02514:Tbx19 APN 1 165153704 missense probably benign 0.15
R0009:Tbx19 UTSW 1 165160520 missense possibly damaging 0.93
R0009:Tbx19 UTSW 1 165160520 missense possibly damaging 0.93
R1600:Tbx19 UTSW 1 165142567 missense possibly damaging 0.52
R4605:Tbx19 UTSW 1 165153584 missense possibly damaging 0.87
R5410:Tbx19 UTSW 1 165160372 missense probably damaging 0.99
R5441:Tbx19 UTSW 1 165153680 missense probably damaging 0.99
R6822:Tbx19 UTSW 1 165140140 missense probably damaging 0.98
R6872:Tbx19 UTSW 1 165147633 critical splice donor site probably null
R7078:Tbx19 UTSW 1 165160566 start gained probably benign
R7711:Tbx19 UTSW 1 165139199 missense probably benign
Z1176:Tbx19 UTSW 1 165142507 missense probably damaging 0.99
Z1177:Tbx19 UTSW 1 165142574 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATGATAAAATACTGCGGGCTG -3'
(R):5'- ACTAGTCAAGTGCAGCAGTGAG -3'

Sequencing Primer
(F):5'- TTGCGGGCTCTCCTGGAC -3'
(R):5'- CAGTGAGCAACGAGACATGTG -3'
Posted On2018-09-12