Incidental Mutation 'R6814:Fam53a'
ID533997
Institutional Source Beutler Lab
Gene Symbol Fam53a
Ensembl Gene ENSMUSG00000037339
Gene Namefamily with sequence similarity 53, member A
Synonyms5430419M09Rik, 2410018C17Rik, DNTNP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R6814 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location33600347-33629635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33610485 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 27 (Y27C)
Ref Sequence ENSEMBL: ENSMUSP00000117350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045329] [ENSMUST00000065119] [ENSMUST00000065162] [ENSMUST00000137705] [ENSMUST00000150033] [ENSMUST00000153696] [ENSMUST00000155980]
Predicted Effect probably benign
Transcript: ENSMUST00000045329
AA Change: Y27C

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000045539
Gene: ENSMUSG00000037339
AA Change: Y27C

DomainStartEndE-ValueType
Pfam:FAM53 1 299 2.2e-113 PFAM
low complexity region 336 356 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065119
AA Change: Y27C

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070770
Gene: ENSMUSG00000037339
AA Change: Y27C

DomainStartEndE-ValueType
Pfam:FAM53 1 299 2.3e-112 PFAM
low complexity region 336 356 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065162
AA Change: Y27C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069521
Gene: ENSMUSG00000037339
AA Change: Y27C

DomainStartEndE-ValueType
Pfam:FAM53 1 299 3.1e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137705
AA Change: Y27C

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121667
Gene: ENSMUSG00000037339
AA Change: Y27C

DomainStartEndE-ValueType
Pfam:FAM53 1 54 4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150033
AA Change: Y27C

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117350
Gene: ENSMUSG00000037339
AA Change: Y27C

DomainStartEndE-ValueType
Pfam:FAM53 1 54 4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153696
AA Change: Y27C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000118139
Gene: ENSMUSG00000037339
AA Change: Y27C

DomainStartEndE-ValueType
Pfam:FAM53 1 59 3.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155980
AA Change: Y27C

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,180 V336I probably benign Het
Abca7 G A 10: 80,002,999 V669I probably damaging Het
Abcg3 T C 5: 104,935,994 T637A probably benign Het
Afap1l1 A T 18: 61,733,741 V749E probably benign Het
Arfgef3 A G 10: 18,595,019 L1666S probably damaging Het
Atp2b1 A G 10: 99,023,015 N284D possibly damaging Het
Ccdc24 T C 4: 117,869,926 T196A probably benign Het
Cdc20b G A 13: 113,083,975 G463S probably damaging Het
Ceacam5 A T 7: 17,752,287 R570* probably null Het
Cit G A 5: 115,884,963 C283Y probably damaging Het
Cpa5 A T 6: 30,614,054 Q65L probably benign Het
Cspg4 A G 9: 56,890,340 I1363V possibly damaging Het
D2hgdh C A 1: 93,835,303 T270N possibly damaging Het
Dnah8 G T 17: 30,762,679 L3058F probably damaging Het
Dnajb8 A G 6: 88,223,040 N186S probably damaging Het
Dock4 T C 12: 40,812,326 probably null Het
Ear6 A G 14: 51,854,428 Y144C probably damaging Het
Fgf2 A G 3: 37,404,711 K85E probably damaging Het
Fubp1 A T 3: 152,226,146 Q37L probably benign Het
Gabra2 G T 5: 71,094,539 P22T probably damaging Het
Gm10401 T C 5: 115,098,186 probably benign Het
Gm436 A T 4: 144,670,646 L172* probably null Het
Gm6657 T A 12: 78,197,367 D31E probably damaging Het
Iglv3 A G 16: 19,241,284 I98T probably damaging Het
Nlrp2 C T 7: 5,308,710 R922H probably benign Het
Nr1h4 T C 10: 89,454,745 T474A probably damaging Het
Pcdhb20 A C 18: 37,506,165 E581D probably benign Het
Pidd1 G T 7: 141,439,418 T750K probably benign Het
Pigq A T 17: 25,931,656 probably benign Het
Rab44 A G 17: 29,139,810 E324G probably benign Het
Slc17a2 T C 13: 23,822,389 I466T possibly damaging Het
Slc24a3 C T 2: 145,616,710 Q537* probably null Het
Slc7a10 T C 7: 35,195,264 V116A probably damaging Het
Taf15 T A 11: 83,499,089 N228K probably damaging Het
Tbx19 A T 1: 165,147,633 probably null Het
Tgoln1 A G 6: 72,615,555 V314A possibly damaging Het
Them4 A T 3: 94,324,371 I172F probably damaging Het
Tmc7 T A 7: 118,547,623 Y477F probably benign Het
Tmem132a A G 19: 10,863,305 L421P probably damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r11 T G 5: 109,047,110 R783S possibly damaging Het
Zfp180 G T 7: 24,105,881 C575F probably damaging Het
Zfp189 A T 4: 49,529,026 N43I probably damaging Het
Zfp36l2 A G 17: 84,186,093 probably benign Het
Zfp592 T C 7: 81,023,828 V180A probably benign Het
Zfp605 C T 5: 110,127,445 P143L probably benign Het
Zfp646 T C 7: 127,883,333 S1561P probably benign Het
Other mutations in Fam53a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Fam53a APN 5 33600827 missense probably benign 0.09
IGL02326:Fam53a APN 5 33600594 missense probably damaging 1.00
IGL02939:Fam53a APN 5 33607759 missense probably damaging 1.00
IGL02988:Fam53a UTSW 5 33607475 missense probably damaging 1.00
R0054:Fam53a UTSW 5 33607732 missense probably damaging 0.99
R0884:Fam53a UTSW 5 33600816 missense probably benign 0.00
R4601:Fam53a UTSW 5 33600663 missense probably benign 0.00
R4808:Fam53a UTSW 5 33607679 missense probably damaging 1.00
R5311:Fam53a UTSW 5 33607736 missense probably damaging 1.00
R6334:Fam53a UTSW 5 33600875 missense probably damaging 1.00
R6525:Fam53a UTSW 5 33607918 missense probably damaging 0.99
R6645:Fam53a UTSW 5 33600784 missense probably benign
R6681:Fam53a UTSW 5 33607840 missense probably damaging 1.00
R7542:Fam53a UTSW 5 33607471 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGTCTCCCTGAAGCTTCTC -3'
(R):5'- AGGTGTTACAAAGGCTTGTCC -3'

Sequencing Primer
(F):5'- GAAGCTTCTCTGACTATCTAATTCAG -3'
(R):5'- GGCAACCTGAGTTTGATCAC -3'
Posted On2018-09-12