Incidental Mutation 'R6814:Abcg3'
ID 533999
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene Name ATP binding cassette subfamily G member 3
Synonyms Abcp2, Mxr2
MMRRC Submission 044926-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R6814 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 105082923-105130584 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105083860 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 637 (T637A)
Ref Sequence ENSEMBL: ENSMUSP00000031239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
AlphaFold Q99P81
Predicted Effect probably benign
Transcript: ENSMUST00000031239
AA Change: T637A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: T637A

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130644
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,349,750 (GRCm39) V336I probably benign Het
Aadacl4fm4 A T 4: 144,397,216 (GRCm39) L172* probably null Het
Abca7 G A 10: 79,838,833 (GRCm39) V669I probably damaging Het
Afap1l1 A T 18: 61,866,812 (GRCm39) V749E probably benign Het
Arfgef3 A G 10: 18,470,767 (GRCm39) L1666S probably damaging Het
Atp2b1 A G 10: 98,858,877 (GRCm39) N284D possibly damaging Het
Ccdc196 T A 12: 78,244,141 (GRCm39) D31E probably damaging Het
Ccdc24 T C 4: 117,727,123 (GRCm39) T196A probably benign Het
Cdc20b G A 13: 113,220,509 (GRCm39) G463S probably damaging Het
Ceacam5 A T 7: 17,486,212 (GRCm39) R570* probably null Het
Cit G A 5: 116,023,022 (GRCm39) C283Y probably damaging Het
Cpa5 A T 6: 30,614,053 (GRCm39) Q65L probably benign Het
Cspg4 A G 9: 56,797,624 (GRCm39) I1363V possibly damaging Het
D2hgdh C A 1: 93,763,025 (GRCm39) T270N possibly damaging Het
Dnah8 G T 17: 30,981,653 (GRCm39) L3058F probably damaging Het
Dnajb8 A G 6: 88,200,022 (GRCm39) N186S probably damaging Het
Dock4 T C 12: 40,862,325 (GRCm39) probably null Het
Ear6 A G 14: 52,091,885 (GRCm39) Y144C probably damaging Het
Fam53a T C 5: 33,767,829 (GRCm39) Y27C probably benign Het
Fgf2 A G 3: 37,458,860 (GRCm39) K85E probably damaging Het
Fubp1 A T 3: 151,931,783 (GRCm39) Q37L probably benign Het
Gabra2 G T 5: 71,251,882 (GRCm39) P22T probably damaging Het
Gm10401 T C 5: 115,236,245 (GRCm39) probably benign Het
Iglv3 A G 16: 19,060,034 (GRCm39) I98T probably damaging Het
Nlrp2 C T 7: 5,311,709 (GRCm39) R922H probably benign Het
Nr1h4 T C 10: 89,290,607 (GRCm39) T474A probably damaging Het
Pcdhb20 A C 18: 37,639,218 (GRCm39) E581D probably benign Het
Pidd1 G T 7: 141,019,331 (GRCm39) T750K probably benign Het
Pigq A T 17: 26,150,630 (GRCm39) probably benign Het
Rab44 A G 17: 29,358,784 (GRCm39) E324G probably benign Het
Slc24a3 C T 2: 145,458,630 (GRCm39) Q537* probably null Het
Slc34a1 T C 13: 24,006,372 (GRCm39) I466T possibly damaging Het
Slc7a10 T C 7: 34,894,689 (GRCm39) V116A probably damaging Het
Taf15 T A 11: 83,389,915 (GRCm39) N228K probably damaging Het
Tbx19 A T 1: 164,975,202 (GRCm39) probably null Het
Tgoln1 A G 6: 72,592,538 (GRCm39) V314A possibly damaging Het
Them4 A T 3: 94,231,678 (GRCm39) I172F probably damaging Het
Tmc7 T A 7: 118,146,846 (GRCm39) Y477F probably benign Het
Tmem132a A G 19: 10,840,669 (GRCm39) L421P probably damaging Het
Vamp5 G A 6: 72,357,424 (GRCm39) probably benign Het
Vmn2r11 T G 5: 109,194,976 (GRCm39) R783S possibly damaging Het
Zfp180 G T 7: 23,805,306 (GRCm39) C575F probably damaging Het
Zfp189 A T 4: 49,529,026 (GRCm39) N43I probably damaging Het
Zfp36l2 A G 17: 84,493,521 (GRCm39) probably benign Het
Zfp592 T C 7: 80,673,576 (GRCm39) V180A probably benign Het
Zfp605 C T 5: 110,275,311 (GRCm39) P143L probably benign Het
Zfp646 T C 7: 127,482,505 (GRCm39) S1561P probably benign Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 105,083,878 (GRCm39) missense probably benign 0.02
IGL01363:Abcg3 APN 5 105,096,228 (GRCm39) missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 105,109,052 (GRCm39) missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 105,117,318 (GRCm39) missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 105,125,536 (GRCm39) missense probably benign 0.18
IGL02974:Abcg3 APN 5 105,116,129 (GRCm39) missense probably damaging 1.00
IGL03058:Abcg3 APN 5 105,109,112 (GRCm39) missense probably benign 0.00
IGL03153:Abcg3 APN 5 105,122,631 (GRCm39) splice site probably benign
IGL03377:Abcg3 APN 5 105,096,256 (GRCm39) missense probably benign 0.01
R0110:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0469:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0510:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0530:Abcg3 UTSW 5 105,083,920 (GRCm39) missense probably damaging 1.00
R0579:Abcg3 UTSW 5 105,121,969 (GRCm39) missense probably damaging 1.00
R1237:Abcg3 UTSW 5 105,096,223 (GRCm39) missense probably damaging 0.96
R1505:Abcg3 UTSW 5 105,099,431 (GRCm39) missense probably damaging 1.00
R1627:Abcg3 UTSW 5 105,083,880 (GRCm39) missense probably benign 0.00
R1717:Abcg3 UTSW 5 105,111,421 (GRCm39) nonsense probably null
R1797:Abcg3 UTSW 5 105,087,030 (GRCm39) missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 105,086,065 (GRCm39) missense probably damaging 0.99
R1974:Abcg3 UTSW 5 105,111,504 (GRCm39) missense probably benign 0.01
R2136:Abcg3 UTSW 5 105,114,680 (GRCm39) missense probably benign 0.04
R2285:Abcg3 UTSW 5 105,087,037 (GRCm39) missense probably damaging 1.00
R3880:Abcg3 UTSW 5 105,086,046 (GRCm39) splice site probably benign
R4242:Abcg3 UTSW 5 105,109,079 (GRCm39) missense probably benign
R4738:Abcg3 UTSW 5 105,121,849 (GRCm39) missense probably benign
R5225:Abcg3 UTSW 5 105,114,649 (GRCm39) missense probably damaging 1.00
R5309:Abcg3 UTSW 5 105,084,465 (GRCm39) missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5705:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5785:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R6155:Abcg3 UTSW 5 105,111,510 (GRCm39) missense probably benign 0.00
R6309:Abcg3 UTSW 5 105,117,259 (GRCm39) critical splice donor site probably null
R6872:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6916:Abcg3 UTSW 5 105,122,601 (GRCm39) missense probably benign 0.16
R7217:Abcg3 UTSW 5 105,087,094 (GRCm39) missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 105,114,632 (GRCm39) missense probably benign 0.01
R7343:Abcg3 UTSW 5 105,116,100 (GRCm39) missense probably benign 0.00
R7401:Abcg3 UTSW 5 105,114,640 (GRCm39) missense probably damaging 0.99
R7531:Abcg3 UTSW 5 105,125,507 (GRCm39) missense probably benign
R7685:Abcg3 UTSW 5 105,116,081 (GRCm39) missense probably damaging 1.00
R7728:Abcg3 UTSW 5 105,083,944 (GRCm39) missense probably benign 0.00
R7819:Abcg3 UTSW 5 105,125,594 (GRCm39) missense probably benign 0.05
R7942:Abcg3 UTSW 5 105,087,027 (GRCm39) missense probably damaging 1.00
R8059:Abcg3 UTSW 5 105,100,948 (GRCm39) critical splice donor site probably null
R9181:Abcg3 UTSW 5 105,121,962 (GRCm39) missense probably benign
R9529:Abcg3 UTSW 5 105,121,973 (GRCm39) missense probably damaging 1.00
R9641:Abcg3 UTSW 5 105,084,483 (GRCm39) missense probably benign
X0022:Abcg3 UTSW 5 105,096,282 (GRCm39) missense probably benign 0.02
X0026:Abcg3 UTSW 5 105,086,055 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAGGGATCCAGTCTTATGC -3'
(R):5'- TTAAGGGAAGCAACAGTGAATCTAC -3'

Sequencing Primer
(F):5'- TGTGAGCAGCCATAAGTCTC -3'
(R):5'- TTGATCTCTCATCGTGGG -3'
Posted On 2018-09-12