Incidental Mutation 'R6814:Tmc7'
ID534013
Institutional Source Beutler Lab
Gene Symbol Tmc7
Ensembl Gene ENSMUSG00000042246
Gene Nametransmembrane channel-like gene family 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6814 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location118535841-118584736 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118547623 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 477 (Y477F)
Ref Sequence ENSEMBL: ENSMUSP00000046927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044195]
Predicted Effect probably benign
Transcript: ENSMUST00000044195
AA Change: Y477F

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000046927
Gene: ENSMUSG00000042246
AA Change: Y477F

DomainStartEndE-ValueType
transmembrane domain 167 189 N/A INTRINSIC
transmembrane domain 216 238 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
transmembrane domain 402 424 N/A INTRINSIC
Pfam:TMC 484 595 5.2e-51 PFAM
transmembrane domain 599 621 N/A INTRINSIC
transmembrane domain 664 686 N/A INTRINSIC
Meta Mutation Damage Score 0.1704 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,180 V336I probably benign Het
Abca7 G A 10: 80,002,999 V669I probably damaging Het
Abcg3 T C 5: 104,935,994 T637A probably benign Het
Afap1l1 A T 18: 61,733,741 V749E probably benign Het
Arfgef3 A G 10: 18,595,019 L1666S probably damaging Het
Atp2b1 A G 10: 99,023,015 N284D possibly damaging Het
Ccdc24 T C 4: 117,869,926 T196A probably benign Het
Cdc20b G A 13: 113,083,975 G463S probably damaging Het
Ceacam5 A T 7: 17,752,287 R570* probably null Het
Cit G A 5: 115,884,963 C283Y probably damaging Het
Cpa5 A T 6: 30,614,054 Q65L probably benign Het
Cspg4 A G 9: 56,890,340 I1363V possibly damaging Het
D2hgdh C A 1: 93,835,303 T270N possibly damaging Het
Dnah8 G T 17: 30,762,679 L3058F probably damaging Het
Dnajb8 A G 6: 88,223,040 N186S probably damaging Het
Dock4 T C 12: 40,812,326 probably null Het
Ear6 A G 14: 51,854,428 Y144C probably damaging Het
Fam53a T C 5: 33,610,485 Y27C probably benign Het
Fgf2 A G 3: 37,404,711 K85E probably damaging Het
Fubp1 A T 3: 152,226,146 Q37L probably benign Het
Gabra2 G T 5: 71,094,539 P22T probably damaging Het
Gm10401 T C 5: 115,098,186 probably benign Het
Gm436 A T 4: 144,670,646 L172* probably null Het
Gm6657 T A 12: 78,197,367 D31E probably damaging Het
Iglv3 A G 16: 19,241,284 I98T probably damaging Het
Nlrp2 C T 7: 5,308,710 R922H probably benign Het
Nr1h4 T C 10: 89,454,745 T474A probably damaging Het
Pcdhb20 A C 18: 37,506,165 E581D probably benign Het
Pidd1 G T 7: 141,439,418 T750K probably benign Het
Pigq A T 17: 25,931,656 probably benign Het
Rab44 A G 17: 29,139,810 E324G probably benign Het
Slc17a2 T C 13: 23,822,389 I466T possibly damaging Het
Slc24a3 C T 2: 145,616,710 Q537* probably null Het
Slc7a10 T C 7: 35,195,264 V116A probably damaging Het
Taf15 T A 11: 83,499,089 N228K probably damaging Het
Tbx19 A T 1: 165,147,633 probably null Het
Tgoln1 A G 6: 72,615,555 V314A possibly damaging Het
Them4 A T 3: 94,324,371 I172F probably damaging Het
Tmem132a A G 19: 10,863,305 L421P probably damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r11 T G 5: 109,047,110 R783S possibly damaging Het
Zfp180 G T 7: 24,105,881 C575F probably damaging Het
Zfp189 A T 4: 49,529,026 N43I probably damaging Het
Zfp36l2 A G 17: 84,186,093 probably benign Het
Zfp592 T C 7: 81,023,828 V180A probably benign Het
Zfp605 C T 5: 110,127,445 P143L probably benign Het
Zfp646 T C 7: 127,883,333 S1561P probably benign Het
Other mutations in Tmc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Tmc7 APN 7 118552762 missense probably damaging 1.00
IGL01456:Tmc7 APN 7 118547310 splice site probably benign
IGL01784:Tmc7 APN 7 118547315 critical splice donor site probably null
IGL02158:Tmc7 APN 7 118538211 missense probably damaging 1.00
PIT4403001:Tmc7 UTSW 7 118547400 missense probably benign 0.04
PIT4403001:Tmc7 UTSW 7 118547401 missense possibly damaging 0.86
PIT4696001:Tmc7 UTSW 7 118564343 missense probably benign 0.04
R1164:Tmc7 UTSW 7 118542024 missense probably benign 0.01
R1169:Tmc7 UTSW 7 118551260 missense probably benign 0.00
R1170:Tmc7 UTSW 7 118551260 missense probably benign 0.00
R1420:Tmc7 UTSW 7 118566217 nonsense probably null
R1885:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1886:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1887:Tmc7 UTSW 7 118561087 missense possibly damaging 0.95
R1923:Tmc7 UTSW 7 118545627 missense probably benign 0.08
R2220:Tmc7 UTSW 7 118552816 missense possibly damaging 0.87
R4858:Tmc7 UTSW 7 118543342 missense probably damaging 1.00
R5000:Tmc7 UTSW 7 118558854 critical splice donor site probably null
R5038:Tmc7 UTSW 7 118543365 missense probably damaging 1.00
R5075:Tmc7 UTSW 7 118552696 critical splice donor site probably null
R5272:Tmc7 UTSW 7 118561053 missense probably benign
R5691:Tmc7 UTSW 7 118541893 missense probably benign
R5800:Tmc7 UTSW 7 118539440 missense probably benign
R5889:Tmc7 UTSW 7 118566326 missense probably benign 0.00
R5939:Tmc7 UTSW 7 118545727 missense probably benign 0.33
R6251:Tmc7 UTSW 7 118561038 missense possibly damaging 0.83
R6642:Tmc7 UTSW 7 118545611 nonsense probably null
R6644:Tmc7 UTSW 7 118538162 missense probably benign
R6872:Tmc7 UTSW 7 118547623 missense probably benign 0.07
R6967:Tmc7 UTSW 7 118547678 missense probably benign 0.00
R7165:Tmc7 UTSW 7 118555934 missense probably benign 0.00
R7492:Tmc7 UTSW 7 118541966 missense probably benign 0.00
R7543:Tmc7 UTSW 7 118545756 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGTCTCCCAGCACTGAAAC -3'
(R):5'- GAAGTTGCCTGTGTTCCTCC -3'

Sequencing Primer
(F):5'- TGGAGACACACTAAGAGACTGACTC -3'
(R):5'- TCCTCAGTGTCAGGTCCAGAG -3'
Posted On2018-09-12