Incidental Mutation 'R6814:Rab44'
ID534028
Institutional Source Beutler Lab
Gene Symbol Rab44
Ensembl Gene ENSMUSG00000064147
Gene NameRAB44, member RAS oncogene family
Synonyms9830134C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6814 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location29135056-29148980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29139810 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 324 (E324G)
Ref Sequence ENSEMBL: ENSMUSP00000085253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087942]
Predicted Effect probably benign
Transcript: ENSMUST00000087942
AA Change: E324G

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000085253
Gene: ENSMUSG00000064147
AA Change: E324G

DomainStartEndE-ValueType
coiled coil region 1 68 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
RAB 538 701 1.11e-53 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.6%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G A 4: 144,623,180 V336I probably benign Het
Abca7 G A 10: 80,002,999 V669I probably damaging Het
Abcg3 T C 5: 104,935,994 T637A probably benign Het
Afap1l1 A T 18: 61,733,741 V749E probably benign Het
Arfgef3 A G 10: 18,595,019 L1666S probably damaging Het
Atp2b1 A G 10: 99,023,015 N284D possibly damaging Het
Ccdc24 T C 4: 117,869,926 T196A probably benign Het
Cdc20b G A 13: 113,083,975 G463S probably damaging Het
Ceacam5 A T 7: 17,752,287 R570* probably null Het
Cit G A 5: 115,884,963 C283Y probably damaging Het
Cpa5 A T 6: 30,614,054 Q65L probably benign Het
Cspg4 A G 9: 56,890,340 I1363V possibly damaging Het
D2hgdh C A 1: 93,835,303 T270N possibly damaging Het
Dnah8 G T 17: 30,762,679 L3058F probably damaging Het
Dnajb8 A G 6: 88,223,040 N186S probably damaging Het
Dock4 T C 12: 40,812,326 probably null Het
Ear6 A G 14: 51,854,428 Y144C probably damaging Het
Fam53a T C 5: 33,610,485 Y27C probably benign Het
Fgf2 A G 3: 37,404,711 K85E probably damaging Het
Fubp1 A T 3: 152,226,146 Q37L probably benign Het
Gabra2 G T 5: 71,094,539 P22T probably damaging Het
Gm10401 T C 5: 115,098,186 probably benign Het
Gm436 A T 4: 144,670,646 L172* probably null Het
Gm6657 T A 12: 78,197,367 D31E probably damaging Het
Iglv3 A G 16: 19,241,284 I98T probably damaging Het
Nlrp2 C T 7: 5,308,710 R922H probably benign Het
Nr1h4 T C 10: 89,454,745 T474A probably damaging Het
Pcdhb20 A C 18: 37,506,165 E581D probably benign Het
Pidd1 G T 7: 141,439,418 T750K probably benign Het
Pigq A T 17: 25,931,656 probably benign Het
Slc17a2 T C 13: 23,822,389 I466T possibly damaging Het
Slc24a3 C T 2: 145,616,710 Q537* probably null Het
Slc7a10 T C 7: 35,195,264 V116A probably damaging Het
Taf15 T A 11: 83,499,089 N228K probably damaging Het
Tbx19 A T 1: 165,147,633 probably null Het
Tgoln1 A G 6: 72,615,555 V314A possibly damaging Het
Them4 A T 3: 94,324,371 I172F probably damaging Het
Tmc7 T A 7: 118,547,623 Y477F probably benign Het
Tmem132a A G 19: 10,863,305 L421P probably damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Vmn2r11 T G 5: 109,047,110 R783S possibly damaging Het
Zfp180 G T 7: 24,105,881 C575F probably damaging Het
Zfp189 A T 4: 49,529,026 N43I probably damaging Het
Zfp36l2 A G 17: 84,186,093 probably benign Het
Zfp592 T C 7: 81,023,828 V180A probably benign Het
Zfp605 C T 5: 110,127,445 P143L probably benign Het
Zfp646 T C 7: 127,883,333 S1561P probably benign Het
Other mutations in Rab44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Rab44 APN 17 29139737 missense probably benign
IGL01545:Rab44 APN 17 29147377 missense unknown
IGL02314:Rab44 APN 17 29139353 missense probably benign 0.04
IGL02402:Rab44 APN 17 29140516 missense probably benign 0.01
IGL02492:Rab44 APN 17 29146049 splice site probably benign
R0018:Rab44 UTSW 17 29139380 missense probably benign 0.03
R0135:Rab44 UTSW 17 29138132 missense probably benign 0.01
R0193:Rab44 UTSW 17 29140307 missense probably benign
R0398:Rab44 UTSW 17 29145370 splice site probably benign
R0403:Rab44 UTSW 17 29145261 missense probably damaging 1.00
R0608:Rab44 UTSW 17 29147343 splice site probably null
R0631:Rab44 UTSW 17 29139144 missense possibly damaging 0.91
R0762:Rab44 UTSW 17 29145270 missense unknown
R1128:Rab44 UTSW 17 29140461 missense possibly damaging 0.90
R1681:Rab44 UTSW 17 29140124 missense possibly damaging 0.47
R1706:Rab44 UTSW 17 29138106 missense probably damaging 1.00
R2679:Rab44 UTSW 17 29144477 splice site probably null
R3500:Rab44 UTSW 17 29138067 missense probably benign 0.09
R3709:Rab44 UTSW 17 29139869 missense probably benign 0.08
R4497:Rab44 UTSW 17 29139897 missense probably benign 0.04
R4655:Rab44 UTSW 17 29139194 missense probably benign
R4833:Rab44 UTSW 17 29136337 missense probably damaging 1.00
R4850:Rab44 UTSW 17 29140089 missense possibly damaging 0.95
R4926:Rab44 UTSW 17 29139555 missense probably benign 0.01
R5694:Rab44 UTSW 17 29140500 missense probably damaging 1.00
R5694:Rab44 UTSW 17 29145966 missense unknown
R5835:Rab44 UTSW 17 29148238 missense probably benign 0.13
R6146:Rab44 UTSW 17 29135417 start gained probably benign
R6629:Rab44 UTSW 17 29135780 start gained probably benign
R6865:Rab44 UTSW 17 29139227 missense probably benign
R6872:Rab44 UTSW 17 29139810 missense probably benign 0.18
R7032:Rab44 UTSW 17 29140464 missense unknown
R7058:Rab44 UTSW 17 29138176 splice site probably null
R7207:Rab44 UTSW 17 29138039 nonsense probably null
R7218:Rab44 UTSW 17 29139444 missense
R7418:Rab44 UTSW 17 29140496 missense unknown
R7651:Rab44 UTSW 17 29148205 missense unknown
Predicted Primers PCR Primer
(F):5'- GATCAGCTTGCTTTTGAGGC -3'
(R):5'- AGCTGCTCCTCTAGACTCTG -3'

Sequencing Primer
(F):5'- CAGCTTGCTTTTGAGGCTGAGC -3'
(R):5'- TCCTCTAGACTCTGGGGGAG -3'
Posted On2018-09-12