Incidental Mutation 'R6824:Cmas'
ID534050
Institutional Source Beutler Lab
Gene Symbol Cmas
Ensembl Gene ENSMUSG00000030282
Gene Namecytidine monophospho-N-acetylneuraminic acid synthetase
SynonymsCMP-Neu5Ac synthase, CMP-sialic acid synthetase, D6Bwg0250e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R6824 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location142756686-142775714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142771236 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 285 (T285A)
Ref Sequence ENSEMBL: ENSMUSP00000032419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032419] [ENSMUST00000133248] [ENSMUST00000144920]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032419
AA Change: T285A

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032419
Gene: ENSMUSG00000030282
AA Change: T285A

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:CTP_transf_3 44 301 3.8e-69 PFAM
Pfam:NTP_transf_3 45 228 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133248
SMART Domains Protein: ENSMUSP00000144875
Gene: ENSMUSG00000030282

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:CTP_transf_3 44 85 2.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144920
SMART Domains Protein: ENSMUSP00000145392
Gene: ENSMUSG00000030282

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:CTP_transf_3 44 85 2.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204147
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that converts N-acetylneuraminic acid (NeuNAc) to cytidine 5'-monophosphate N-acetylneuraminic acid (CMP-NeuNAc). This process is important in the formation of sialylated glycoprotein and glycolipids. This modification plays a role in cell-cell communications and immune responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 A G 6: 39,575,124 D275G probably benign Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Chl1 A G 6: 103,714,549 K1051E probably damaging Het
Chn2 A T 6: 54,272,953 M16L probably benign Het
Cnga4 A T 7: 105,406,829 M213L probably benign Het
Ctif C T 18: 75,521,711 R248Q probably damaging Het
Cyth3 T C 5: 143,686,510 I60T probably damaging Het
Dach1 A G 14: 98,018,892 I310T possibly damaging Het
Defb6 T C 8: 19,228,083 I57T probably benign Het
Dnajc27 T C 12: 4,106,897 V262A possibly damaging Het
Emsy G A 7: 98,593,407 T1175M probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat4 T A 3: 38,957,525 V2258E probably benign Het
Gm136 G A 4: 34,746,591 T140I probably benign Het
Gm1673 T C 5: 33,983,725 probably benign Het
Gps1 T C 11: 120,787,428 F265S probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hnrnpul2 T C 19: 8,826,717 V560A possibly damaging Het
Kmt2b A G 7: 30,586,276 probably benign Het
Krt8 T C 15: 101,998,440 N317S possibly damaging Het
Lad1 A G 1: 135,827,741 T252A probably benign Het
Maml2 G A 9: 13,697,217 S743N possibly damaging Het
Mrpl9 C A 3: 94,443,370 P7H possibly damaging Het
Myb T A 10: 21,145,120 H470L probably benign Het
Nr1i3 T C 1: 171,214,973 I56T probably benign Het
Nrd1 A G 4: 109,043,425 Y338C probably damaging Het
Olfr702 A G 7: 106,824,457 V23A probably benign Het
Pcdhb20 T A 18: 37,505,699 M426K probably benign Het
Pde6d T C 1: 86,545,763 T104A possibly damaging Het
Ptprz1 A T 6: 23,002,131 T1407S probably benign Het
Recql5 C T 11: 115,923,212 R369Q possibly damaging Het
Rnf180 T A 13: 105,181,515 D463V probably damaging Het
Sart3 C T 5: 113,744,539 probably null Het
Sdk2 T C 11: 113,867,934 D488G probably benign Het
Slc9a9 C T 9: 95,227,198 P538S probably damaging Het
Snap29 A G 16: 17,422,506 K159E probably benign Het
Spaca1 A G 4: 34,049,869 V43A probably benign Het
Stk10 T C 11: 32,587,363 S191P probably damaging Het
Tbc1d1 A G 5: 64,256,902 H73R probably benign Het
Tcerg1l A G 7: 138,394,115 probably null Het
Tmem67 T C 4: 12,051,449 Y793C probably damaging Het
Ttll12 A T 15: 83,591,377 probably null Het
Vmn2r61 G T 7: 42,299,979 V608L probably benign Het
Xpo4 A T 14: 57,613,403 I348N probably damaging Het
Zfp941 G A 7: 140,812,699 T249M probably benign Het
Other mutations in Cmas
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0558:Cmas UTSW 6 142775244 nonsense probably null
R0798:Cmas UTSW 6 142764656 missense probably damaging 1.00
R1172:Cmas UTSW 6 142756878 missense probably benign 0.01
R1453:Cmas UTSW 6 142772127 missense probably damaging 1.00
R1983:Cmas UTSW 6 142770586 missense probably damaging 0.98
R2147:Cmas UTSW 6 142771289 missense probably benign 0.18
R3795:Cmas UTSW 6 142767868 missense probably benign 0.03
R4378:Cmas UTSW 6 142772285 unclassified probably benign
R4768:Cmas UTSW 6 142764431 critical splice donor site probably null
R6430:Cmas UTSW 6 142767924 missense probably benign
R6774:Cmas UTSW 6 142764421 missense possibly damaging 0.81
R6980:Cmas UTSW 6 142756800 missense probably damaging 0.97
R7256:Cmas UTSW 6 142770586 missense probably damaging 1.00
R7776:Cmas UTSW 6 142764557 missense probably damaging 0.99
R7969:Cmas UTSW 6 142775166 missense probably damaging 1.00
R8325:Cmas UTSW 6 142771339 critical splice donor site probably null
R8363:Cmas UTSW 6 142756828 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGTGTCTGAGTGGTCCACAG -3'
(R):5'- ATCTCTTAAGTGCTGGAGTGC -3'

Sequencing Primer
(F):5'- CTCAGAGCAGTGTCTGAGTGAC -3'
(R):5'- GAGTGCTCCCTGAATCAGAATCTTG -3'
Posted On2018-09-12