Incidental Mutation 'R6824:Emsy'
ID534054
Institutional Source Beutler Lab
Gene Symbol Emsy
Ensembl Gene ENSMUSG00000035401
Gene NameEMSY, BRCA2-interacting transcriptional repressor
Synonyms2210018M11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.565) question?
Stock #R6824 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location98587137-98656783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98593407 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1175 (T1175M)
Ref Sequence ENSEMBL: ENSMUSP00000145858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038359] [ENSMUST00000205276] [ENSMUST00000205886] [ENSMUST00000205911] [ENSMUST00000206626]
Predicted Effect probably benign
Transcript: ENSMUST00000038359
SMART Domains Protein: ENSMUSP00000038216
Gene: ENSMUSG00000035401

DomainStartEndE-ValueType
ENT 16 88 2.44e-29 SMART
low complexity region 94 104 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
low complexity region 293 331 N/A INTRINSIC
low complexity region 363 406 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 681 698 N/A INTRINSIC
low complexity region 807 816 N/A INTRINSIC
low complexity region 866 882 N/A INTRINSIC
low complexity region 893 909 N/A INTRINSIC
low complexity region 1197 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205276
AA Change: T1175M

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000205886
Predicted Effect unknown
Transcript: ENSMUST00000205911
AA Change: T981M
Predicted Effect probably benign
Transcript: ENSMUST00000206626
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 A G 6: 39,575,124 D275G probably benign Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Chl1 A G 6: 103,714,549 K1051E probably damaging Het
Chn2 A T 6: 54,272,953 M16L probably benign Het
Cmas A G 6: 142,771,236 T285A possibly damaging Het
Cnga4 A T 7: 105,406,829 M213L probably benign Het
Ctif C T 18: 75,521,711 R248Q probably damaging Het
Cyth3 T C 5: 143,686,510 I60T probably damaging Het
Dach1 A G 14: 98,018,892 I310T possibly damaging Het
Defb6 T C 8: 19,228,083 I57T probably benign Het
Dnajc27 T C 12: 4,106,897 V262A possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat4 T A 3: 38,957,525 V2258E probably benign Het
Gm136 G A 4: 34,746,591 T140I probably benign Het
Gm1673 T C 5: 33,983,725 probably benign Het
Gps1 T C 11: 120,787,428 F265S probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hnrnpul2 T C 19: 8,826,717 V560A possibly damaging Het
Kmt2b A G 7: 30,586,276 probably benign Het
Krt8 T C 15: 101,998,440 N317S possibly damaging Het
Lad1 A G 1: 135,827,741 T252A probably benign Het
Maml2 G A 9: 13,697,217 S743N possibly damaging Het
Mrpl9 C A 3: 94,443,370 P7H possibly damaging Het
Myb T A 10: 21,145,120 H470L probably benign Het
Nr1i3 T C 1: 171,214,973 I56T probably benign Het
Nrd1 A G 4: 109,043,425 Y338C probably damaging Het
Olfr702 A G 7: 106,824,457 V23A probably benign Het
Pcdhb20 T A 18: 37,505,699 M426K probably benign Het
Pde6d T C 1: 86,545,763 T104A possibly damaging Het
Ptprz1 A T 6: 23,002,131 T1407S probably benign Het
Recql5 C T 11: 115,923,212 R369Q possibly damaging Het
Rnf180 T A 13: 105,181,515 D463V probably damaging Het
Sart3 C T 5: 113,744,539 probably null Het
Sdk2 T C 11: 113,867,934 D488G probably benign Het
Slc9a9 C T 9: 95,227,198 P538S probably damaging Het
Snap29 A G 16: 17,422,506 K159E probably benign Het
Spaca1 A G 4: 34,049,869 V43A probably benign Het
Stk10 T C 11: 32,587,363 S191P probably damaging Het
Tbc1d1 A G 5: 64,256,902 H73R probably benign Het
Tcerg1l A G 7: 138,394,115 probably null Het
Tmem67 T C 4: 12,051,449 Y793C probably damaging Het
Ttll12 A T 15: 83,591,377 probably null Het
Vmn2r61 G T 7: 42,299,979 V608L probably benign Het
Xpo4 A T 14: 57,613,403 I348N probably damaging Het
Zfp941 G A 7: 140,812,699 T249M probably benign Het
Other mutations in Emsy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Emsy APN 7 98593455 missense probably benign 0.09
IGL01357:Emsy APN 7 98590870 nonsense probably null
IGL01620:Emsy APN 7 98626624 missense probably damaging 1.00
IGL01750:Emsy APN 7 98619301 missense probably damaging 0.99
IGL02032:Emsy APN 7 98590780 missense possibly damaging 0.94
IGL02388:Emsy APN 7 98641666 missense probably damaging 0.99
IGL03089:Emsy APN 7 98637266 nonsense probably null
IGL03272:Emsy APN 7 98593762 missense probably damaging 0.98
IGL03347:Emsy APN 7 98610685 missense probably damaging 0.99
IGL03400:Emsy APN 7 98602726 missense possibly damaging 0.94
IGL02980:Emsy UTSW 7 98619380 missense probably damaging 0.97
R0576:Emsy UTSW 7 98593776 missense probably damaging 0.99
R1102:Emsy UTSW 7 98602589 missense probably damaging 0.97
R1323:Emsy UTSW 7 98610657 splice site probably benign
R1438:Emsy UTSW 7 98621406 missense possibly damaging 0.88
R1439:Emsy UTSW 7 98600841 intron probably benign
R1452:Emsy UTSW 7 98600674 missense probably damaging 0.96
R1515:Emsy UTSW 7 98590856 missense probably damaging 1.00
R1535:Emsy UTSW 7 98593737 missense possibly damaging 0.94
R1791:Emsy UTSW 7 98647880 missense probably damaging 0.99
R1829:Emsy UTSW 7 98602729 missense possibly damaging 0.95
R1829:Emsy UTSW 7 98602730 missense possibly damaging 0.88
R1848:Emsy UTSW 7 98600821 missense probably damaging 0.99
R1861:Emsy UTSW 7 98641615 missense probably damaging 1.00
R1929:Emsy UTSW 7 98626623 missense probably damaging 0.99
R1957:Emsy UTSW 7 98647820 missense probably damaging 1.00
R2221:Emsy UTSW 7 98590775 missense possibly damaging 0.83
R2223:Emsy UTSW 7 98590775 missense possibly damaging 0.83
R2271:Emsy UTSW 7 98626623 missense probably damaging 0.99
R4078:Emsy UTSW 7 98590725 missense probably damaging 0.99
R4707:Emsy UTSW 7 98597104 missense possibly damaging 0.94
R4783:Emsy UTSW 7 98646479 missense possibly damaging 0.74
R5453:Emsy UTSW 7 98600806 missense probably damaging 0.97
R5518:Emsy UTSW 7 98593611 missense possibly damaging 0.86
R5828:Emsy UTSW 7 98593492 missense probably benign
R5945:Emsy UTSW 7 98619383 missense probably damaging 0.97
R6153:Emsy UTSW 7 98610853 missense probably damaging 1.00
R7068:Emsy UTSW 7 98610761 missense probably benign 0.17
R7381:Emsy UTSW 7 98590803 missense probably damaging 0.98
R7417:Emsy UTSW 7 98615486 missense probably damaging 1.00
R7488:Emsy UTSW 7 98615555 missense possibly damaging 0.94
R7499:Emsy UTSW 7 98630331 missense possibly damaging 0.59
R7646:Emsy UTSW 7 98619353 missense probably damaging 1.00
R7682:Emsy UTSW 7 98590698 missense probably damaging 0.99
R7716:Emsy UTSW 7 98599766 missense unknown
R7789:Emsy UTSW 7 98621489 missense probably damaging 1.00
R7794:Emsy UTSW 7 98600724 missense probably benign 0.30
R7832:Emsy UTSW 7 98639853 missense probably damaging 1.00
R7974:Emsy UTSW 7 98630218 missense possibly damaging 0.73
R7996:Emsy UTSW 7 98593681 missense probably benign 0.00
R8070:Emsy UTSW 7 98626715 missense possibly damaging 0.73
R8221:Emsy UTSW 7 98647904 missense probably damaging 1.00
X0067:Emsy UTSW 7 98630240 missense possibly damaging 0.65
Z1088:Emsy UTSW 7 98600722 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTCCTTGAAGTGACTGACTAGTCC -3'
(R):5'- GCAAATGTCTTTGATGGAAGCTC -3'

Sequencing Primer
(F):5'- TAGTCCTGTGACATCCCAAAATGG -3'
(R):5'- TAGAACATATGGTAGTGGATCCCCC -3'
Posted On2018-09-12