Mutagenetix > Incidental Mutation

Incidental Mutation 'R6824:Stk10'

534063

Institutional Source

Beutler Lab

Gene Symbol

Stk10

Ensembl Gene

ENSMUSG00000020272

Gene Name

serine/threonine kinase 10

Synonyms

Gek1, Lok

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R6824 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32533305-32624587 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32587363 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 191 (S191P)

Ref Sequence

ENSEMBL: ENSMUSP00000099885 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102821]

AlphaFold

O55098

Predicted Effect

probably damaging
Transcript: ENSMUST00000102821
AA Change: S191P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099885
Gene: ENSMUSG00000020272
AA Change: S191P

Domain	Start	End	E-Value	Type
S_TKc	36	294	8.66e-92	SMART
low complexity region	316	334	N/A	INTRINSIC
low complexity region	544	577	N/A	INTRINSIC
Pfam:PKK	586	724	1.9e-41	PFAM
Pfam:PKK	754	894	2.2e-37	PFAM

Meta Mutation Damage Score

0.8604

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: This gene encodes a member of the Ste20 family of serine/threonine protein kinases, and is similar to several known polo-like kinase kinases. Mice deficient for this gene product are viable, but exhibit altered integrin-mediated lymphocyte adhesion characteristics. The orthologous gene product in humans can associate with and phosphorylate polo-like kinase 1, and overexpression of a kinase-dead version of the protein interferes with normal cell cycle progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in enhanced cell adhesion in mitogen-stimulated T cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck2	A	G	6: 39,575,124	D275G	probably benign	Het
Cdh4	G	A	2: 179,797,558	R166H	probably damaging	Het
Chl1	A	G	6: 103,714,549	K1051E	probably damaging	Het
Chn2	A	T	6: 54,272,953	M16L	probably benign	Het
Cmas	A	G	6: 142,771,236	T285A	possibly damaging	Het
Cnga4	A	T	7: 105,406,829	M213L	probably benign	Het
Ctif	C	T	18: 75,521,711	R248Q	probably damaging	Het
Cyth3	T	C	5: 143,686,510	I60T	probably damaging	Het
Dach1	A	G	14: 98,018,892	I310T	possibly damaging	Het
Defb6	T	C	8: 19,228,083	I57T	probably benign	Het
Dnajc27	T	C	12: 4,106,897	V262A	possibly damaging	Het
Emsy	G	A	7: 98,593,407	T1175M	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Fat4	T	A	3: 38,957,525	V2258E	probably benign	Het
Gm136	G	A	4: 34,746,591	T140I	probably benign	Het
Gm1673	T	C	5: 33,983,725		probably benign	Het
Gps1	T	C	11: 120,787,428	F265S	probably damaging	Het
Grik5	C	T	7: 25,046,355	R431Q	possibly damaging	Het
Hnrnpul2	T	C	19: 8,826,717	V560A	possibly damaging	Het
Kmt2b	A	G	7: 30,586,276		probably benign	Het
Krt8	T	C	15: 101,998,440	N317S	possibly damaging	Het
Lad1	A	G	1: 135,827,741	T252A	probably benign	Het
Maml2	G	A	9: 13,697,217	S743N	possibly damaging	Het
Mrpl9	C	A	3: 94,443,370	P7H	possibly damaging	Het
Myb	T	A	10: 21,145,120	H470L	probably benign	Het
Nr1i3	T	C	1: 171,214,973	I56T	probably benign	Het
Nrd1	A	G	4: 109,043,425	Y338C	probably damaging	Het
Olfr702	A	G	7: 106,824,457	V23A	probably benign	Het
Pcdhb20	T	A	18: 37,505,699	M426K	probably benign	Het
Pde6d	T	C	1: 86,545,763	T104A	possibly damaging	Het
Ptprz1	A	T	6: 23,002,131	T1407S	probably benign	Het
Recql5	C	T	11: 115,923,212	R369Q	possibly damaging	Het
Rnf180	T	A	13: 105,181,515	D463V	probably damaging	Het
Sart3	C	T	5: 113,744,539		probably null	Het
Sdk2	T	C	11: 113,867,934	D488G	probably benign	Het
Slc9a9	C	T	9: 95,227,198	P538S	probably damaging	Het
Snap29	A	G	16: 17,422,506	K159E	probably benign	Het
Spaca1	A	G	4: 34,049,869	V43A	probably benign	Het
Tbc1d1	A	G	5: 64,256,902	H73R	probably benign	Het
Tcerg1l	A	G	7: 138,394,115		probably null	Het
Tmem67	T	C	4: 12,051,449	Y793C	probably damaging	Het
Ttll12	A	T	15: 83,591,377		probably null	Het
Vmn2r61	G	T	7: 42,299,979	V608L	probably benign	Het
Xpo4	A	T	14: 57,613,403	I348N	probably damaging	Het
Zfp941	G	A	7: 140,812,699	T249M	probably benign	Het

Other mutations in Stk10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Stk10	APN	11	32577740	missense	probably benign	0.33
IGL01285:Stk10	APN	11	32610653	missense	possibly damaging	0.91
IGL01983:Stk10	APN	11	32589460	missense	probably benign	0.05
IGL03177:Stk10	APN	11	32614592	missense	probably damaging	1.00
IGL03183:Stk10	APN	11	32604143	missense	possibly damaging	0.50
coquet	UTSW	11	32577764	missense
legacy	UTSW	11	32604166	nonsense	probably null
mignon	UTSW	11	32587363	missense	probably damaging	1.00
R0481_stk10_383	UTSW	11	32614708	missense	probably damaging	1.00
FR4976:Stk10	UTSW	11	32614520	critical splice acceptor site	probably benign
R0003:Stk10	UTSW	11	32589460	missense	probably benign	0.05
R0008:Stk10	UTSW	11	32587305	splice site	probably benign
R0056:Stk10	UTSW	11	32617851	missense	possibly damaging	0.95
R0076:Stk10	UTSW	11	32603722	missense	probably benign
R0227:Stk10	UTSW	11	32617859	missense	probably damaging	1.00
R0440:Stk10	UTSW	11	32604190	missense	probably damaging	1.00
R0454:Stk10	UTSW	11	32596724	missense	probably damaging	0.99
R0481:Stk10	UTSW	11	32614708	missense	probably damaging	1.00
R0504:Stk10	UTSW	11	32617882	missense	probably benign	0.04
R0790:Stk10	UTSW	11	32598653	missense	probably benign	0.00
R1439:Stk10	UTSW	11	32617919	missense	probably damaging	0.98
R1539:Stk10	UTSW	11	32533440	missense	possibly damaging	0.85
R1770:Stk10	UTSW	11	32622464	missense	possibly damaging	0.94
R4304:Stk10	UTSW	11	32610634	missense	probably damaging	0.97
R4430:Stk10	UTSW	11	32533552	missense	possibly damaging	0.81
R4702:Stk10	UTSW	11	32555172	missense	probably benign	0.28
R4797:Stk10	UTSW	11	32598471	missense	probably benign	0.01
R5447:Stk10	UTSW	11	32604166	nonsense	probably null
R5801:Stk10	UTSW	11	32596748	missense	probably benign	0.01
R5802:Stk10	UTSW	11	32596748	missense	probably benign	0.01
R6129:Stk10	UTSW	11	32615871	missense	probably damaging	1.00
R6154:Stk10	UTSW	11	32603654	splice site	probably null
R6175:Stk10	UTSW	11	32603761	missense	possibly damaging	0.46
R6185:Stk10	UTSW	11	32577749	missense	probably benign	0.13
R6520:Stk10	UTSW	11	32588839	missense	probably damaging	1.00
R7259:Stk10	UTSW	11	32598497	missense	probably benign	0.00
R7649:Stk10	UTSW	11	32577764	missense
R8331:Stk10	UTSW	11	32588928	missense
R8847:Stk10	UTSW	11	32589427	missense
R9252:Stk10	UTSW	11	32588915	missense
R9367:Stk10	UTSW	11	32588878	missense
X0027:Stk10	UTSW	11	32587361	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ATCCCCGAGTCCCGAAATTG -3'
(R):5'- ACTGTAACCCCAGTTTACAGACG -3'

Sequencing Primer
(F):5'- GAAATTGTGTTCCTGAGTCCACAC -3'
(R):5'- AGCTAAGCCACTTGTGCTAG -3'

Posted On

2018-09-12