Incidental Mutation 'R6824:Krt8'
ID 534073
Institutional Source Beutler Lab
Gene Symbol Krt8
Ensembl Gene ENSMUSG00000049382
Gene Name keratin 8
Synonyms Krt-2.8, Krt2-8, cytokeratin 8, cytokeratin8, K8, EndoA, cytokeratin-8, Card2
MMRRC Submission 044936-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6824 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 101996698-102004482 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 101998440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 317 (N317S)
Ref Sequence ENSEMBL: ENSMUSP00000023952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023952]
AlphaFold P11679
Predicted Effect possibly damaging
Transcript: ENSMUST00000023952
AA Change: N317S

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023952
Gene: ENSMUSG00000049382
AA Change: N317S

DomainStartEndE-ValueType
Pfam:Keratin_2_head 1 93 9.4e-18 PFAM
Filament 96 407 7.82e-188 SMART
low complexity region 421 438 N/A INTRINSIC
Meta Mutation Damage Score 0.7137 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show partial background-sensitive embryonic lethality, placental defects, impaired female fertility, abnormal hematopoiesis, diarrhea, colorectal hyperplasia, anorectal prolapse, and high liver sensitivity to toxins, apoptotic stimuli and diet-induced steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 A G 6: 39,575,124 D275G probably benign Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Chl1 A G 6: 103,714,549 K1051E probably damaging Het
Chn2 A T 6: 54,272,953 M16L probably benign Het
Cmas A G 6: 142,771,236 T285A possibly damaging Het
Cnga4 A T 7: 105,406,829 M213L probably benign Het
Ctif C T 18: 75,521,711 R248Q probably damaging Het
Cyth3 T C 5: 143,686,510 I60T probably damaging Het
Dach1 A G 14: 98,018,892 I310T possibly damaging Het
Defb6 T C 8: 19,228,083 I57T probably benign Het
Dnajc27 T C 12: 4,106,897 V262A possibly damaging Het
Emsy G A 7: 98,593,407 T1175M probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat4 T A 3: 38,957,525 V2258E probably benign Het
Gm136 G A 4: 34,746,591 T140I probably benign Het
Gm1673 T C 5: 33,983,725 probably benign Het
Gps1 T C 11: 120,787,428 F265S probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hnrnpul2 T C 19: 8,826,717 V560A possibly damaging Het
Kmt2b A G 7: 30,586,276 probably benign Het
Lad1 A G 1: 135,827,741 T252A probably benign Het
Maml2 G A 9: 13,697,217 S743N possibly damaging Het
Mrpl9 C A 3: 94,443,370 P7H possibly damaging Het
Myb T A 10: 21,145,120 H470L probably benign Het
Nr1i3 T C 1: 171,214,973 I56T probably benign Het
Nrd1 A G 4: 109,043,425 Y338C probably damaging Het
Olfr702 A G 7: 106,824,457 V23A probably benign Het
Pcdhb20 T A 18: 37,505,699 M426K probably benign Het
Pde6d T C 1: 86,545,763 T104A possibly damaging Het
Ptprz1 A T 6: 23,002,131 T1407S probably benign Het
Recql5 C T 11: 115,923,212 R369Q possibly damaging Het
Rnf180 T A 13: 105,181,515 D463V probably damaging Het
Sart3 C T 5: 113,744,539 probably null Het
Sdk2 T C 11: 113,867,934 D488G probably benign Het
Slc9a9 C T 9: 95,227,198 P538S probably damaging Het
Snap29 A G 16: 17,422,506 K159E probably benign Het
Spaca1 A G 4: 34,049,869 V43A probably benign Het
Stk10 T C 11: 32,587,363 S191P probably damaging Het
Tbc1d1 A G 5: 64,256,902 H73R probably benign Het
Tcerg1l A G 7: 138,394,115 probably null Het
Tmem67 T C 4: 12,051,449 Y793C probably damaging Het
Ttll12 A T 15: 83,591,377 probably null Het
Vmn2r61 G T 7: 42,299,979 V608L probably benign Het
Xpo4 A T 14: 57,613,403 I348N probably damaging Het
Zfp941 G A 7: 140,812,699 T249M probably benign Het
Other mutations in Krt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Krt8 APN 15 101998025 missense probably benign
IGL01643:Krt8 APN 15 101997073 missense possibly damaging 0.64
IGL01966:Krt8 APN 15 101997670 missense probably benign 0.08
IGL02587:Krt8 APN 15 101998932 missense probably benign 0.04
IGL03088:Krt8 APN 15 102000587 missense possibly damaging 0.90
R0531:Krt8 UTSW 15 102001448 missense probably benign 0.12
R1451:Krt8 UTSW 15 101998829 missense possibly damaging 0.93
R2258:Krt8 UTSW 15 101998822 missense probably benign
R2348:Krt8 UTSW 15 101998865 missense probably benign 0.31
R2566:Krt8 UTSW 15 101998024 missense probably benign 0.03
R3796:Krt8 UTSW 15 101999442 missense probably benign 0.00
R4834:Krt8 UTSW 15 101998821 missense probably damaging 1.00
R4965:Krt8 UTSW 15 101996951 missense probably benign
R5212:Krt8 UTSW 15 101997967 missense possibly damaging 0.52
R5249:Krt8 UTSW 15 101998440 missense possibly damaging 0.69
R5419:Krt8 UTSW 15 102003902 missense probably damaging 0.98
R5778:Krt8 UTSW 15 102003939 missense probably damaging 0.99
R5997:Krt8 UTSW 15 102000594 missense possibly damaging 0.77
R6503:Krt8 UTSW 15 101997934 missense possibly damaging 0.66
R6683:Krt8 UTSW 15 101998004 missense probably benign
R6812:Krt8 UTSW 15 101997979 missense probably damaging 0.99
R6875:Krt8 UTSW 15 101997908 missense probably benign 0.44
R7650:Krt8 UTSW 15 102004163 missense probably benign 0.07
R8047:Krt8 UTSW 15 102003971 missense probably damaging 0.99
R8559:Krt8 UTSW 15 102001544 missense probably benign 0.03
R8826:Krt8 UTSW 15 102001435 missense possibly damaging 0.89
R9146:Krt8 UTSW 15 101998935 missense probably damaging 0.98
R9565:Krt8 UTSW 15 102004025 missense probably benign 0.26
Z1177:Krt8 UTSW 15 101999435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGTATGTCCCTCCCTAAGG -3'
(R):5'- TGGACTGGCTCCACACAATG -3'

Sequencing Primer
(F):5'- CCAGGCTGGCCTTGAATTTACAG -3'
(R):5'- TCTGGAAAGGGGCCTTCACTG -3'
Posted On 2018-09-12