Mutagenetix > Incidental Mutation

Incidental Mutation 'R6824:Enpp5'

534075

Institutional Source

Beutler Lab

Gene Symbol

Enpp5

Ensembl Gene

ENSMUSG00000023960

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 5

Synonyms

D17Abb1e

MMRRC Submission

044936-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6824 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44078813-44086567 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 44085264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 356 (G356S)

Ref Sequence

ENSEMBL: ENSMUSP00000122767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024756] [ENSMUST00000126032] [ENSMUST00000154166]

AlphaFold

Q9EQG7

Predicted Effect

probably damaging
Transcript: ENSMUST00000024756
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000024756
Gene: ENSMUSG00000023960
AA Change: G356S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Phosphodiest	30	342	7.1e-91	PFAM
transmembrane domain	430	452	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126032

Predicted Effect

probably damaging
Transcript: ENSMUST00000154166
AA Change: G356S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122767
Gene: ENSMUSG00000023960
AA Change: G356S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:Phosphodiest	30	342	2.1e-86	PFAM
transmembrane domain	430	452	N/A	INTRINSIC

Meta Mutation Damage Score

0.9168

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I transmembrane glycoprotein. Studies in rat suggest the encoded protein may play a role in neuronal cell communications. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2014]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck2	A	G	6: 39,575,124	D275G	probably benign	Het
Cdh4	G	A	2: 179,797,558	R166H	probably damaging	Het
Chl1	A	G	6: 103,714,549	K1051E	probably damaging	Het
Chn2	A	T	6: 54,272,953	M16L	probably benign	Het
Cmas	A	G	6: 142,771,236	T285A	possibly damaging	Het
Cnga4	A	T	7: 105,406,829	M213L	probably benign	Het
Ctif	C	T	18: 75,521,711	R248Q	probably damaging	Het
Cyth3	T	C	5: 143,686,510	I60T	probably damaging	Het
Dach1	A	G	14: 98,018,892	I310T	possibly damaging	Het
Defb6	T	C	8: 19,228,083	I57T	probably benign	Het
Dnajc27	T	C	12: 4,106,897	V262A	possibly damaging	Het
Emsy	G	A	7: 98,593,407	T1175M	probably benign	Het
Fam50b	G	A	13: 34,747,101	E187K	possibly damaging	Het
Fat4	T	A	3: 38,957,525	V2258E	probably benign	Het
Gm136	G	A	4: 34,746,591	T140I	probably benign	Het
Gm1673	T	C	5: 33,983,725		probably benign	Het
Gps1	T	C	11: 120,787,428	F265S	probably damaging	Het
Grik5	C	T	7: 25,046,355	R431Q	possibly damaging	Het
Hnrnpul2	T	C	19: 8,826,717	V560A	possibly damaging	Het
Kmt2b	A	G	7: 30,586,276		probably benign	Het
Krt8	T	C	15: 101,998,440	N317S	possibly damaging	Het
Lad1	A	G	1: 135,827,741	T252A	probably benign	Het
Maml2	G	A	9: 13,697,217	S743N	possibly damaging	Het
Mrpl9	C	A	3: 94,443,370	P7H	possibly damaging	Het
Myb	T	A	10: 21,145,120	H470L	probably benign	Het
Nr1i3	T	C	1: 171,214,973	I56T	probably benign	Het
Nrd1	A	G	4: 109,043,425	Y338C	probably damaging	Het
Olfr702	A	G	7: 106,824,457	V23A	probably benign	Het
Pcdhb20	T	A	18: 37,505,699	M426K	probably benign	Het
Pde6d	T	C	1: 86,545,763	T104A	possibly damaging	Het
Ptprz1	A	T	6: 23,002,131	T1407S	probably benign	Het
Recql5	C	T	11: 115,923,212	R369Q	possibly damaging	Het
Rnf180	T	A	13: 105,181,515	D463V	probably damaging	Het
Sart3	C	T	5: 113,744,539		probably null	Het
Sdk2	T	C	11: 113,867,934	D488G	probably benign	Het
Slc9a9	C	T	9: 95,227,198	P538S	probably damaging	Het
Snap29	A	G	16: 17,422,506	K159E	probably benign	Het
Spaca1	A	G	4: 34,049,869	V43A	probably benign	Het
Stk10	T	C	11: 32,587,363	S191P	probably damaging	Het
Tbc1d1	A	G	5: 64,256,902	H73R	probably benign	Het
Tcerg1l	A	G	7: 138,394,115		probably null	Het
Tmem67	T	C	4: 12,051,449	Y793C	probably damaging	Het
Ttll12	A	T	15: 83,591,377		probably null	Het
Vmn2r61	G	T	7: 42,299,979	V608L	probably benign	Het
Xpo4	A	T	14: 57,613,403	I348N	probably damaging	Het
Zfp941	G	A	7: 140,812,699	T249M	probably benign	Het

Other mutations in Enpp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00583:Enpp5	APN	17	44085197	splice site	probably benign
IGL01593:Enpp5	APN	17	44080721	missense	probably benign
IGL01654:Enpp5	APN	17	44081175	missense	possibly damaging	0.82
IGL02120:Enpp5	APN	17	44080845	missense	probably benign	0.04
IGL02142:Enpp5	APN	17	44085577	missense	probably benign	0.01
IGL02531:Enpp5	APN	17	44080952	missense	probably damaging	1.00
IGL02630:Enpp5	APN	17	44082875	missense	probably damaging	1.00
Cacao	UTSW	17	44085576	missense	probably benign	0.00
canola	UTSW	17	44085264	missense	probably damaging	1.00
R1101:Enpp5	UTSW	17	44081367	missense	possibly damaging	0.77
R2074:Enpp5	UTSW	17	44085373	missense	probably benign	0.25
R2679:Enpp5	UTSW	17	44085388	missense	probably damaging	1.00
R4739:Enpp5	UTSW	17	44081136	missense	probably damaging	1.00
R4817:Enpp5	UTSW	17	44080980	makesense	probably null
R5152:Enpp5	UTSW	17	44081133	missense	probably damaging	1.00
R6021:Enpp5	UTSW	17	44085319	missense	probably benign	0.22
R6160:Enpp5	UTSW	17	44081368	missense	possibly damaging	0.77
R6330:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6385:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6387:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6452:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6454:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6461:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6462:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6463:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6469:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6470:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6471:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6473:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6505:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6563:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6564:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6760:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6812:Enpp5	UTSW	17	44085576	missense	probably benign	0.00
R6821:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6963:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R6965:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7169:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7171:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7375:Enpp5	UTSW	17	44080977	missense	probably benign	0.02
R7393:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7394:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7411:Enpp5	UTSW	17	44081475	missense	probably damaging	1.00
R7412:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7446:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7447:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7560:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7561:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7589:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7590:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R7591:Enpp5	UTSW	17	44085264	missense	probably damaging	1.00
R8211:Enpp5	UTSW	17	44081511	critical splice donor site	probably null
R9256:Enpp5	UTSW	17	44085523	missense	probably benign	0.00
R9321:Enpp5	UTSW	17	44082798	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- GCCTGTAAGAAAGACGGGTATC -3'
(R):5'- ACTCTGTGTGTAAGGAATTGGC -3'

Sequencing Primer
(F):5'- GACGGGTATCTAGGTAACATTTGAC -3'
(R):5'- CTTGGGAGTTGCTGAACTGAGAAG -3'

Posted On

2018-09-12