Incidental Mutation 'R6824:Ctif'
ID534077
Institutional Source Beutler Lab
Gene Symbol Ctif
Ensembl Gene ENSMUSG00000052928
Gene NameCBP80/20-dependent translation initiation factor
SynonymsLOC269037, Gm672
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6824 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location75431224-75697696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75521711 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 248 (R248Q)
Ref Sequence ENSEMBL: ENSMUSP00000129974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165559]
Predicted Effect probably damaging
Transcript: ENSMUST00000165559
AA Change: R248Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129974
Gene: ENSMUSG00000052928
AA Change: R248Q

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
low complexity region 347 360 N/A INTRINSIC
MIF4G 401 602 5.46e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CTIF is a component of the CBP80 (NCBP1; MIM 600469)/CBP20 (NCBP2; MIM 605133) translation initiation complex that binds cotranscriptionally to the cap end of nascent mRNA. The CBP80/CBP20 complex is involved in a simultaneous editing and translation step that recognizes premature termination codons (PTCs) in mRNAs and directs PTC-containing mRNAs toward nonsense-mediated decay (NMD). On mRNAs without PTCs, the CBP80/CBP20 complex is replaced with cytoplasmic mRNA cap-binding proteins, including EIF4G (MIM 600495), and steady-state translation of the mRNAs resumes in the cytoplasm (Kim et al., 2009 [PubMed 19648179]).[supplied by OMIM, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck2 A G 6: 39,575,124 D275G probably benign Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Chl1 A G 6: 103,714,549 K1051E probably damaging Het
Chn2 A T 6: 54,272,953 M16L probably benign Het
Cmas A G 6: 142,771,236 T285A possibly damaging Het
Cnga4 A T 7: 105,406,829 M213L probably benign Het
Cyth3 T C 5: 143,686,510 I60T probably damaging Het
Dach1 A G 14: 98,018,892 I310T possibly damaging Het
Defb6 T C 8: 19,228,083 I57T probably benign Het
Dnajc27 T C 12: 4,106,897 V262A possibly damaging Het
Emsy G A 7: 98,593,407 T1175M probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat4 T A 3: 38,957,525 V2258E probably benign Het
Gm136 G A 4: 34,746,591 T140I probably benign Het
Gm1673 T C 5: 33,983,725 probably benign Het
Gps1 T C 11: 120,787,428 F265S probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Hnrnpul2 T C 19: 8,826,717 V560A possibly damaging Het
Kmt2b A G 7: 30,586,276 probably benign Het
Krt8 T C 15: 101,998,440 N317S possibly damaging Het
Lad1 A G 1: 135,827,741 T252A probably benign Het
Maml2 G A 9: 13,697,217 S743N possibly damaging Het
Mrpl9 C A 3: 94,443,370 P7H possibly damaging Het
Myb T A 10: 21,145,120 H470L probably benign Het
Nr1i3 T C 1: 171,214,973 I56T probably benign Het
Nrd1 A G 4: 109,043,425 Y338C probably damaging Het
Olfr702 A G 7: 106,824,457 V23A probably benign Het
Pcdhb20 T A 18: 37,505,699 M426K probably benign Het
Pde6d T C 1: 86,545,763 T104A possibly damaging Het
Ptprz1 A T 6: 23,002,131 T1407S probably benign Het
Recql5 C T 11: 115,923,212 R369Q possibly damaging Het
Rnf180 T A 13: 105,181,515 D463V probably damaging Het
Sart3 C T 5: 113,744,539 probably null Het
Sdk2 T C 11: 113,867,934 D488G probably benign Het
Slc9a9 C T 9: 95,227,198 P538S probably damaging Het
Snap29 A G 16: 17,422,506 K159E probably benign Het
Spaca1 A G 4: 34,049,869 V43A probably benign Het
Stk10 T C 11: 32,587,363 S191P probably damaging Het
Tbc1d1 A G 5: 64,256,902 H73R probably benign Het
Tcerg1l A G 7: 138,394,115 probably null Het
Tmem67 T C 4: 12,051,449 Y793C probably damaging Het
Ttll12 A T 15: 83,591,377 probably null Het
Vmn2r61 G T 7: 42,299,979 V608L probably benign Het
Xpo4 A T 14: 57,613,403 I348N probably damaging Het
Zfp941 G A 7: 140,812,699 T249M probably benign Het
Other mutations in Ctif
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Ctif APN 18 75437176 missense possibly damaging 0.95
IGL01481:Ctif APN 18 75611784 splice site probably benign
IGL02299:Ctif APN 18 75637245 missense probably damaging 1.00
IGL02319:Ctif APN 18 75521873 splice site probably benign
IGL03130:Ctif APN 18 75521618 missense probably benign
R0304:Ctif UTSW 18 75521818 missense probably benign 0.09
R0730:Ctif UTSW 18 75565012 missense probably damaging 0.99
R0835:Ctif UTSW 18 75435336 missense probably damaging 1.00
R1226:Ctif UTSW 18 75521579 small deletion probably benign
R1302:Ctif UTSW 18 75521678 missense probably benign 0.22
R1549:Ctif UTSW 18 75565025 missense probably damaging 1.00
R1674:Ctif UTSW 18 75637180 missense probably benign 0.00
R1697:Ctif UTSW 18 75624305 splice site probably benign
R1848:Ctif UTSW 18 75519941 missense probably damaging 0.96
R2102:Ctif UTSW 18 75521381 missense probably benign
R3499:Ctif UTSW 18 75611757 missense possibly damaging 0.94
R3878:Ctif UTSW 18 75519977 missense probably damaging 0.96
R4157:Ctif UTSW 18 75435270 missense probably benign 0.42
R4168:Ctif UTSW 18 75637215 missense probably damaging 1.00
R4225:Ctif UTSW 18 75435237 missense probably benign 0.01
R4560:Ctif UTSW 18 75519881 missense probably damaging 1.00
R4822:Ctif UTSW 18 75521561 missense probably benign 0.01
R5176:Ctif UTSW 18 75637219 missense probably damaging 1.00
R5824:Ctif UTSW 18 75610678 missense possibly damaging 0.55
R6934:Ctif UTSW 18 75435360 missense probably benign 0.07
R7014:Ctif UTSW 18 75437208 missense possibly damaging 0.82
R7115:Ctif UTSW 18 75471803 critical splice donor site probably benign
R7169:Ctif UTSW 18 75472016 missense probably damaging 0.99
R7187:Ctif UTSW 18 75637219 missense probably damaging 1.00
R7355:Ctif UTSW 18 75610685 missense probably damaging 0.98
R7402:Ctif UTSW 18 75611736 missense probably benign 0.18
R7451:Ctif UTSW 18 75519803 missense possibly damaging 0.82
R7648:Ctif UTSW 18 75637142 missense probably benign 0.04
R7671:Ctif UTSW 18 75472016 missense probably damaging 0.99
R7746:Ctif UTSW 18 75471803 critical splice donor site probably benign
R7765:Ctif UTSW 18 75605644 missense probably damaging 1.00
R7805:Ctif UTSW 18 75471803 critical splice donor site probably benign
X0027:Ctif UTSW 18 75637263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTCAGGAAGAACAGTGTC -3'
(R):5'- TTCGTAGACGGCAGCAAAG -3'

Sequencing Primer
(F):5'- CGCTCAGGAAGAACAGTGTCTTTATG -3'
(R):5'- GTAGACGGCAGCAAAGACCTC -3'
Posted On2018-09-12