Incidental Mutation 'R6825:Zap70'
ID534079
Institutional Source Beutler Lab
Gene Symbol Zap70
Ensembl Gene ENSMUSG00000026117
Gene Namezeta-chain (TCR) associated protein kinase
SynonymsZAP-70, TZK, Srk
MMRRC Submission
Accession Numbers

Genbank: NM_009539; MGI: 99613

 

Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R6825 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location36761798-36782818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36778390 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 238 (Y238C)
Ref Sequence ENSEMBL: ENSMUSP00000027291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027291]
Predicted Effect probably damaging
Transcript: ENSMUST00000027291
AA Change: Y238C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027291
Gene: ENSMUSG00000026117
AA Change: Y238C

DomainStartEndE-ValueType
SH2 8 93 6.73e-25 SMART
SH2 161 245 1.59e-26 SMART
low complexity region 257 265 N/A INTRINSIC
TyrKc 337 592 1e-128 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is essential for development of T lymphocytes and thymocytes, and functions in the initial step of T lymphocyte receptor-mediated signal transduction. A mutation in this gene causes chronic autoimmune arthritis, similar to rheumatoid arthritis in humans. Mice lacking this gene are deficient in alpha-beta T lymphocytes in the thymus. In humans, mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T lymphocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant mice show T cell defects. Null mutants lack alpha-beta T cells in the thymus and have fewer T cells in dendritic and intestinal epithelium. Spontaneous and knock-in missense mutations affect T cell receptor signaling, one of the former resulting in severe chronic arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Targeted, other(7) Gene trapped(1) Spontaneous(2) Chemically induced(3)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,907,880 S206T probably benign Het
Aasdh A T 5: 76,888,849 probably null Het
Adam10 G T 9: 70,761,602 C400F probably damaging Het
Ankle2 A T 5: 110,250,769 R561S probably null Het
Arhgef5 C T 6: 43,274,961 T882I probably damaging Het
Arpc1a A T 5: 145,096,126 K82* probably null Het
Card11 C A 5: 140,878,082 R967L probably benign Het
Ccdc82 G T 9: 13,251,976 probably benign Het
Cebpz T C 17: 78,919,963 D1026G probably damaging Het
Cit A T 5: 115,981,774 Q1321L probably damaging Het
Clcn2 C A 16: 20,709,658 probably benign Het
Csf3 G C 11: 98,702,447 G130A probably damaging Het
Cul2 T A 18: 3,434,946 S737T probably damaging Het
Cyp1a2 G A 9: 57,677,260 H504Y probably benign Het
Cyp3a44 G A 5: 145,779,586 P398L probably damaging Het
Dnah8 T C 17: 30,741,173 I2206T probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Epb41l5 A T 1: 119,620,201 D157E possibly damaging Het
Ercc8 T C 13: 108,158,809 S6P probably damaging Het
Faxc T C 4: 21,931,672 S37P probably benign Het
Fbxl19 T A 7: 127,750,015 I119K probably damaging Het
Frmd4b A G 6: 97,325,476 V195A possibly damaging Het
Fut9 A T 4: 25,619,925 S296R probably benign Het
Gas6 T C 8: 13,483,674 N112D probably benign Het
H2-Q1 T C 17: 35,321,052 L99P probably damaging Het
Helq A T 5: 100,792,695 I346N probably damaging Het
Hepacam A G 9: 37,367,680 K2E possibly damaging Het
Itgae T C 11: 73,118,496 M502T possibly damaging Het
Kmt2a G A 9: 44,818,407 probably benign Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Macf1 A T 4: 123,383,222 probably null Het
Mgat4a T A 1: 37,464,434 K220* probably null Het
Olfr1199 T C 2: 88,755,911 I255V possibly damaging Het
Olfr1469 G A 19: 13,411,150 V194I probably benign Het
Olfr224 T C 11: 58,566,650 R232G possibly damaging Het
Pex5 A T 6: 124,414,381 M18K probably damaging Het
Phlda3 T C 1: 135,766,824 *126Q probably null Het
Plxna1 G T 6: 89,320,615 D1862E probably benign Het
Pold4 A T 19: 4,232,110 I7F possibly damaging Het
Prkaa1 A T 15: 5,143,950 I19F possibly damaging Het
Prl7d1 T G 13: 27,710,142 E148A probably benign Het
Prr14l A T 5: 32,828,548 V1201E possibly damaging Het
Rab3gap1 T C 1: 127,930,421 C510R probably damaging Het
Rhbdf1 C T 11: 32,209,970 R802H probably damaging Het
Rpl18a A C 8: 70,896,192 F47V probably damaging Het
Sema5b C A 16: 35,628,007 probably null Het
Sspo G A 6: 48,465,525 G1985R probably benign Het
Tcaf2 C T 6: 42,629,518 A501T probably benign Het
Tcerg1 A G 18: 42,548,477 D563G probably damaging Het
Tdh G A 14: 63,495,832 T155M probably damaging Het
Tenm2 T C 11: 36,046,884 N1654S probably benign Het
Tlr5 A T 1: 182,973,044 probably benign Het
Tns1 G T 1: 74,002,323 C136* probably null Het
Tomm5 A T 4: 45,106,443 probably null Het
Trio A T 15: 27,889,308 F512I probably damaging Het
Ttll5 A T 12: 85,883,328 probably null Het
Upp1 T A 11: 9,131,707 H81Q probably benign Het
Usp42 A G 5: 143,727,807 S71P probably damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Zfp398 A G 6: 47,866,331 D307G probably damaging Het
Other mutations in Zap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
mrtless APN 1 36781149 missense probably damaging 1.00
murdock APN 1 36779704 missense probably damaging 0.99
IGL00763:Zap70 APN 1 36779252 missense possibly damaging 0.81
IGL01635:Zap70 APN 1 36771157 missense probably damaging 0.99
IGL01918:Zap70 APN 1 36778787 missense possibly damaging 0.64
IGL02164:Zap70 APN 1 36771186 missense probably damaging 0.99
IGL02502:Zap70 APN 1 36778806 splice site probably benign
IGL02597:Zap70 APN 1 36771920 nonsense probably null
IGL03026:Zap70 APN 1 36779717 missense possibly damaging 0.94
biscayne UTSW 1 36781412 missense probably damaging 1.00
mesa_verde UTSW 1 36779173 missense probably damaging 1.00
trebia UTSW 1 36781025 missense probably damaging 1.00
wanna UTSW 1 36770983 missense probably damaging 1.00
wanna2 UTSW 1 36781412 missense probably damaging 1.00
wanna3 UTSW 1 36778218 missense probably damaging 0.99
wanna4 UTSW 1 36781365 missense probably damaging 1.00
want_to UTSW 1 36782517 missense probably damaging 1.00
waterfowl UTSW 1 36770811 start codon destroyed probably null 0.03
zapatos UTSW 1 36771181 missense possibly damaging 0.89
zipper UTSW 1 36770902 missense probably benign 0.09
PIT1430001:Zap70 UTSW 1 36779169 missense possibly damaging 0.95
R0487:Zap70 UTSW 1 36779284 missense probably damaging 1.00
R0701:Zap70 UTSW 1 36781177 missense probably damaging 1.00
R0960:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R1520:Zap70 UTSW 1 36770955 missense probably damaging 1.00
R2064:Zap70 UTSW 1 36779134 missense probably benign
R3623:Zap70 UTSW 1 36779135 missense probably benign 0.03
R3689:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3690:Zap70 UTSW 1 36781412 missense probably damaging 1.00
R3804:Zap70 UTSW 1 36771142 missense possibly damaging 0.58
R3840:Zap70 UTSW 1 36778417 missense probably damaging 1.00
R4260:Zap70 UTSW 1 36779108 splice site probably benign
R4383:Zap70 UTSW 1 36780961 missense probably damaging 1.00
R4632:Zap70 UTSW 1 36778458 missense probably benign
R4783:Zap70 UTSW 1 36779173 missense probably damaging 1.00
R5051:Zap70 UTSW 1 36781451 missense probably benign 0.00
R5271:Zap70 UTSW 1 36781365 missense probably damaging 1.00
R5304:Zap70 UTSW 1 36778218 missense probably damaging 0.99
R5792:Zap70 UTSW 1 36779009 intron probably benign
R5932:Zap70 UTSW 1 36781146 missense probably damaging 1.00
R5941:Zap70 UTSW 1 36770949 missense probably damaging 1.00
R6694:Zap70 UTSW 1 36782517 missense probably damaging 1.00
R7039:Zap70 UTSW 1 36778751 missense probably benign
R7704:Zap70 UTSW 1 36779314 critical splice donor site probably null
R7769:Zap70 UTSW 1 36770902 missense probably benign 0.09
R8115:Zap70 UTSW 1 36781206 missense probably damaging 1.00
R8140:Zap70 UTSW 1 36771181 missense possibly damaging 0.89
R8289:Zap70 UTSW 1 36781137 missense probably damaging 1.00
S24628:Zap70 UTSW 1 36770811 start codon destroyed probably null 0.03
Z1176:Zap70 UTSW 1 36779176 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATCTCATCAGCCAGGACAAGG -3'
(R):5'- TCCCAGTGTCACGTCTCAAC -3'

Sequencing Primer
(F):5'- ACAAGGCTGGCAAGTACTG -3'
(R):5'- TCAACGCTGAGGTGCCAC -3'
Posted On2018-09-12