Incidental Mutation 'R6825:Epb41l5'
ID 534082
Institutional Source Beutler Lab
Gene Symbol Epb41l5
Ensembl Gene ENSMUSG00000026383
Gene Name erythrocyte membrane protein band 4.1 like 5
Synonyms E230025E14Rik, 1700030C16Rik, Epb4.1l5, NBL5, Lulu1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6825 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 119545037-119649000 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119620201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 157 (D157E)
Ref Sequence ENSEMBL: ENSMUSP00000128374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027632] [ENSMUST00000052404] [ENSMUST00000163147] [ENSMUST00000187194] [ENSMUST00000191046]
AlphaFold Q8BGS1
Predicted Effect probably benign
Transcript: ENSMUST00000027632
AA Change: D157E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000027632
Gene: ENSMUSG00000026383
AA Change: D157E

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052404
AA Change: D157E

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058966
Gene: ENSMUSG00000026383
AA Change: D157E

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
coiled coil region 482 512 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163147
AA Change: D157E

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128374
Gene: ENSMUSG00000026383
AA Change: D157E

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 420 429 N/A INTRINSIC
coiled coil region 490 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187194
SMART Domains Protein: ENSMUSP00000139683
Gene: ENSMUSG00000026383

DomainStartEndE-ValueType
Pfam:FERM_N 47 114 1.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191046
AA Change: D157E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000140227
Gene: ENSMUSG00000026383
AA Change: D157E

DomainStartEndE-ValueType
B41 39 235 8.64e-68 SMART
FERM_C 239 331 1.07e-34 SMART
FA 336 380 1.16e-12 SMART
low complexity region 412 421 N/A INTRINSIC
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a number of different mutations exhibit prenatal lethality and mesodermal and epithelial-mesenchymal transition defects during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,907,880 S206T probably benign Het
Aasdh A T 5: 76,888,849 probably null Het
Adam10 G T 9: 70,761,602 C400F probably damaging Het
Ankle2 A T 5: 110,250,769 R561S probably null Het
Arhgef5 C T 6: 43,274,961 T882I probably damaging Het
Arpc1a A T 5: 145,096,126 K82* probably null Het
Card11 C A 5: 140,878,082 R967L probably benign Het
Ccdc82 G T 9: 13,251,976 probably benign Het
Cebpz T C 17: 78,919,963 D1026G probably damaging Het
Cit A T 5: 115,981,774 Q1321L probably damaging Het
Clcn2 C A 16: 20,709,658 probably benign Het
Csf3 G C 11: 98,702,447 G130A probably damaging Het
Cul2 T A 18: 3,434,946 S737T probably damaging Het
Cyp1a2 G A 9: 57,677,260 H504Y probably benign Het
Cyp3a44 G A 5: 145,779,586 P398L probably damaging Het
Dnah8 T C 17: 30,741,173 I2206T probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Ercc8 T C 13: 108,158,809 S6P probably damaging Het
Faxc T C 4: 21,931,672 S37P probably benign Het
Fbxl19 T A 7: 127,750,015 I119K probably damaging Het
Frmd4b A G 6: 97,325,476 V195A possibly damaging Het
Fut9 A T 4: 25,619,925 S296R probably benign Het
Gas6 T C 8: 13,483,674 N112D probably benign Het
H2-Q1 T C 17: 35,321,052 L99P probably damaging Het
Helq A T 5: 100,792,695 I346N probably damaging Het
Hepacam A G 9: 37,367,680 K2E possibly damaging Het
Itgae T C 11: 73,118,496 M502T possibly damaging Het
Kmt2a G A 9: 44,818,407 probably benign Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Macf1 A T 4: 123,383,222 probably null Het
Mgat4a T A 1: 37,464,434 K220* probably null Het
Olfr1199 T C 2: 88,755,911 I255V possibly damaging Het
Olfr1469 G A 19: 13,411,150 V194I probably benign Het
Olfr224 T C 11: 58,566,650 R232G possibly damaging Het
Pex5 A T 6: 124,414,381 M18K probably damaging Het
Phlda3 T C 1: 135,766,824 *126Q probably null Het
Plxna1 G T 6: 89,320,615 D1862E probably benign Het
Pold4 A T 19: 4,232,110 I7F possibly damaging Het
Prkaa1 A T 15: 5,143,950 I19F possibly damaging Het
Prl7d1 T G 13: 27,710,142 E148A probably benign Het
Prr14l A T 5: 32,828,548 V1201E possibly damaging Het
Rab3gap1 T C 1: 127,930,421 C510R probably damaging Het
Rhbdf1 C T 11: 32,209,970 R802H probably damaging Het
Rpl18a A C 8: 70,896,192 F47V probably damaging Het
Sema5b C A 16: 35,628,007 probably null Het
Sspo G A 6: 48,465,525 G1985R probably benign Het
Tcaf2 C T 6: 42,629,518 A501T probably benign Het
Tcerg1 A G 18: 42,548,477 D563G probably damaging Het
Tdh G A 14: 63,495,832 T155M probably damaging Het
Tenm2 T C 11: 36,046,884 N1654S probably benign Het
Tlr5 A T 1: 182,973,044 probably benign Het
Tns1 G T 1: 74,002,323 C136* probably null Het
Tomm5 A T 4: 45,106,443 probably null Het
Trio A T 15: 27,889,308 F512I probably damaging Het
Ttll5 A T 12: 85,883,328 probably null Het
Upp1 T A 11: 9,131,707 H81Q probably benign Het
Usp42 A G 5: 143,727,807 S71P probably damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Zap70 A G 1: 36,778,390 Y238C probably damaging Het
Zfp398 A G 6: 47,866,331 D307G probably damaging Het
Other mutations in Epb41l5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Epb41l5 APN 1 119567847 missense probably benign 0.03
IGL01983:Epb41l5 APN 1 119579084 splice site probably benign
IGL02085:Epb41l5 APN 1 119572856 missense probably benign
IGL02834:Epb41l5 APN 1 119623955 missense probably benign 0.22
IGL02975:Epb41l5 APN 1 119579081 splice site probably benign
IGL03001:Epb41l5 APN 1 119617644 missense probably damaging 1.00
IGL03331:Epb41l5 APN 1 119617419 missense probably damaging 1.00
R0096:Epb41l5 UTSW 1 119623911 splice site probably benign
R0124:Epb41l5 UTSW 1 119633640 nonsense probably null
R0128:Epb41l5 UTSW 1 119549902 missense possibly damaging 0.81
R0130:Epb41l5 UTSW 1 119549902 missense possibly damaging 0.81
R0241:Epb41l5 UTSW 1 119567779 splice site probably null
R0357:Epb41l5 UTSW 1 119609204 missense probably damaging 1.00
R0624:Epb41l5 UTSW 1 119623958 missense probably damaging 1.00
R0711:Epb41l5 UTSW 1 119623911 splice site probably benign
R0848:Epb41l5 UTSW 1 119549954 missense probably benign 0.01
R1340:Epb41l5 UTSW 1 119549131 makesense probably null
R1401:Epb41l5 UTSW 1 119578904 splice site probably benign
R1416:Epb41l5 UTSW 1 119549876 splice site probably benign
R1452:Epb41l5 UTSW 1 119549166 missense probably damaging 1.00
R1646:Epb41l5 UTSW 1 119550022 splice site probably benign
R1889:Epb41l5 UTSW 1 119549172 missense possibly damaging 0.82
R1895:Epb41l5 UTSW 1 119549172 missense possibly damaging 0.82
R3082:Epb41l5 UTSW 1 119609262 missense probably damaging 1.00
R3742:Epb41l5 UTSW 1 119605243 missense probably benign
R4194:Epb41l5 UTSW 1 119608093 missense probably damaging 1.00
R4787:Epb41l5 UTSW 1 119595995 missense probably benign 0.00
R4983:Epb41l5 UTSW 1 119555071 missense probably benign 0.00
R6943:Epb41l5 UTSW 1 119609129 missense probably damaging 1.00
R6944:Epb41l5 UTSW 1 119609129 missense probably damaging 1.00
R7334:Epb41l5 UTSW 1 119623949 missense probably damaging 1.00
R8553:Epb41l5 UTSW 1 119549941 missense possibly damaging 0.88
R8904:Epb41l5 UTSW 1 119620206 missense probably damaging 1.00
R8955:Epb41l5 UTSW 1 119642562 missense probably damaging 1.00
R9147:Epb41l5 UTSW 1 119642589 missense probably damaging 1.00
R9258:Epb41l5 UTSW 1 119578971 missense probably benign
R9351:Epb41l5 UTSW 1 119549909 missense probably benign 0.01
R9366:Epb41l5 UTSW 1 119620718 missense probably damaging 1.00
R9370:Epb41l5 UTSW 1 119633582 missense probably damaging 1.00
R9680:Epb41l5 UTSW 1 119608074 missense probably damaging 1.00
R9779:Epb41l5 UTSW 1 119617363 critical splice donor site probably null
Z1177:Epb41l5 UTSW 1 119609211 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCCTTTAAAACCAAGCAGAATTC -3'
(R):5'- TGAAACCCAGGAGCAGTGTG -3'

Sequencing Primer
(F):5'- GCAGAATTCAAAAGCCCGACG -3'
(R):5'- AGCACTGTCTCCAGCAGAGTTATG -3'
Posted On 2018-09-12