Mutagenetix > Incidental Mutation

Incidental Mutation 'R6825:Fut9'

534089

Institutional Source

Beutler Lab

Gene Symbol

Fut9

Ensembl Gene

ENSMUSG00000055373

Gene Name

fucosyltransferase 9

Synonyms

mFuc-TIX, mFUT9

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6825 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25609332-25800244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25619925 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 296 (S296R)

Ref Sequence

ENSEMBL: ENSMUSP00000103834 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]

AlphaFold

O88819

Predicted Effect

probably benign
Transcript: ENSMUST00000084770
AA Change: S296R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: S296R

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_10	6	358	2.9e-140	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108199
AA Change: S296R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: S296R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:Glyco_tran_10_N	61	169	1.4e-43	PFAM
Pfam:Glyco_transf_10	185	357	4.8e-69	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	A	T	12: 72,907,880	S206T	probably benign	Het
Aasdh	A	T	5: 76,888,849		probably null	Het
Adam10	G	T	9: 70,761,602	C400F	probably damaging	Het
Ankle2	A	T	5: 110,250,769	R561S	probably null	Het
Arhgef5	C	T	6: 43,274,961	T882I	probably damaging	Het
Arpc1a	A	T	5: 145,096,126	K82*	probably null	Het
Card11	C	A	5: 140,878,082	R967L	probably benign	Het
Ccdc82	G	T	9: 13,251,976		probably benign	Het
Cebpz	T	C	17: 78,919,963	D1026G	probably damaging	Het
Cit	A	T	5: 115,981,774	Q1321L	probably damaging	Het
Clcn2	C	A	16: 20,709,658		probably benign	Het
Csf3	G	C	11: 98,702,447	G130A	probably damaging	Het
Cul2	T	A	18: 3,434,946	S737T	probably damaging	Het
Cyp1a2	G	A	9: 57,677,260	H504Y	probably benign	Het
Cyp3a44	G	A	5: 145,779,586	P398L	probably damaging	Het
Dnah8	T	C	17: 30,741,173	I2206T	probably damaging	Het
Efr3a	G	A	15: 65,829,830	V198I	probably benign	Het
Epb41l5	A	T	1: 119,620,201	D157E	possibly damaging	Het
Ercc8	T	C	13: 108,158,809	S6P	probably damaging	Het
Faxc	T	C	4: 21,931,672	S37P	probably benign	Het
Fbxl19	T	A	7: 127,750,015	I119K	probably damaging	Het
Frmd4b	A	G	6: 97,325,476	V195A	possibly damaging	Het
Gas6	T	C	8: 13,483,674	N112D	probably benign	Het
H2-Q1	T	C	17: 35,321,052	L99P	probably damaging	Het
Helq	A	T	5: 100,792,695	I346N	probably damaging	Het
Hepacam	A	G	9: 37,367,680	K2E	possibly damaging	Het
Itgae	T	C	11: 73,118,496	M502T	possibly damaging	Het
Kmt2a	G	A	9: 44,818,407		probably benign	Het
Lhx9	ACC	ACCC	1: 138,841,806		probably null	Het
Macf1	A	T	4: 123,383,222		probably null	Het
Mgat4a	T	A	1: 37,464,434	K220*	probably null	Het
Olfr1199	T	C	2: 88,755,911	I255V	possibly damaging	Het
Olfr1469	G	A	19: 13,411,150	V194I	probably benign	Het
Olfr224	T	C	11: 58,566,650	R232G	possibly damaging	Het
Pex5	A	T	6: 124,414,381	M18K	probably damaging	Het
Phlda3	T	C	1: 135,766,824	*126Q	probably null	Het
Plxna1	G	T	6: 89,320,615	D1862E	probably benign	Het
Pold4	A	T	19: 4,232,110	I7F	possibly damaging	Het
Prkaa1	A	T	15: 5,143,950	I19F	possibly damaging	Het
Prl7d1	T	G	13: 27,710,142	E148A	probably benign	Het
Prr14l	A	T	5: 32,828,548	V1201E	possibly damaging	Het
Rab3gap1	T	C	1: 127,930,421	C510R	probably damaging	Het
Rhbdf1	C	T	11: 32,209,970	R802H	probably damaging	Het
Rpl18a	A	C	8: 70,896,192	F47V	probably damaging	Het
Sema5b	C	A	16: 35,628,007		probably null	Het
Sspo	G	A	6: 48,465,525	G1985R	probably benign	Het
Tcaf2	C	T	6: 42,629,518	A501T	probably benign	Het
Tcerg1	A	G	18: 42,548,477	D563G	probably damaging	Het
Tdh	G	A	14: 63,495,832	T155M	probably damaging	Het
Tenm2	T	C	11: 36,046,884	N1654S	probably benign	Het
Tlr5	A	T	1: 182,973,044		probably benign	Het
Tns1	G	T	1: 74,002,323	C136*	probably null	Het
Tomm5	A	T	4: 45,106,443		probably null	Het
Trio	A	T	15: 27,889,308	F512I	probably damaging	Het
Ttll5	A	T	12: 85,883,328		probably null	Het
Upp1	T	A	11: 9,131,707	H81Q	probably benign	Het
Usp42	A	G	5: 143,727,807	S71P	probably damaging	Het
Vamp5	G	A	6: 72,380,441		probably benign	Het
Zap70	A	G	1: 36,778,390	Y238C	probably damaging	Het
Zfp398	A	G	6: 47,866,331	D307G	probably damaging	Het

Other mutations in Fut9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00919:Fut9	APN	4	25620316	missense	possibly damaging	0.71
IGL01134:Fut9	APN	4	25620446	missense	probably benign	0.13
IGL01330:Fut9	APN	4	25619791	missense	possibly damaging	0.95
IGL01732:Fut9	APN	4	25619867	missense	possibly damaging	0.58
IGL02824:Fut9	APN	4	25620037	missense	probably damaging	1.00
ANU74:Fut9	UTSW	4	25620802	missense	probably benign	0.25
R0280:Fut9	UTSW	4	25619852	missense	probably benign	0.00
R0408:Fut9	UTSW	4	25620319	missense	possibly damaging	0.69
R0594:Fut9	UTSW	4	25620526	missense	possibly damaging	0.94
R0609:Fut9	UTSW	4	25620811	start codon destroyed	probably null	0.98
R0709:Fut9	UTSW	4	25620359	missense	probably damaging	1.00
R1567:Fut9	UTSW	4	25620344	missense	probably damaging	0.99
R1719:Fut9	UTSW	4	25619744	missense	possibly damaging	0.62
R1856:Fut9	UTSW	4	25620352	missense	probably damaging	1.00
R2036:Fut9	UTSW	4	25620322	missense	probably damaging	1.00
R2165:Fut9	UTSW	4	25619733	makesense	probably null
R2165:Fut9	UTSW	4	25619734	makesense	probably null
R2332:Fut9	UTSW	4	25619823	nonsense	probably null
R4539:Fut9	UTSW	4	25619793	missense	probably damaging	1.00
R4722:Fut9	UTSW	4	25799734	utr 5 prime	probably benign
R4766:Fut9	UTSW	4	25799191	intron	probably benign
R4937:Fut9	UTSW	4	25799591	splice site	probably benign
R5025:Fut9	UTSW	4	25620502	missense	probably damaging	1.00
R5032:Fut9	UTSW	4	25799245	intron	probably benign
R5158:Fut9	UTSW	4	25620731	missense	probably benign	0.01
R5601:Fut9	UTSW	4	25620299	missense	probably benign	0.00
R5974:Fut9	UTSW	4	25620090	nonsense	probably null
R6315:Fut9	UTSW	4	25619774	missense	probably damaging	1.00
R6385:Fut9	UTSW	4	25620328	missense	probably damaging	1.00
R6652:Fut9	UTSW	4	25620619	missense	probably benign	0.44
R6809:Fut9	UTSW	4	25620647	missense	probably benign
R7145:Fut9	UTSW	4	25620507	missense	probably damaging	0.96
R7573:Fut9	UTSW	4	25620691	missense	probably benign	0.04
R8933:Fut9	UTSW	4	25619861	missense	probably damaging	1.00
R9715:Fut9	UTSW	4	25620679	missense	probably benign	0.00
X0057:Fut9	UTSW	4	25799686	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- CACTGTGACAATGATGGACAC -3'
(R):5'- ACCTATGGCCAAGCATTCG -3'

Sequencing Primer
(F):5'- GTGACAATGATGGACACTTTAATTCC -3'
(R):5'- CGTGAACGATAAAAATCTGATTCCC -3'

Posted On

2018-09-12