Incidental Mutation 'R6825:Fut9'
ID 534089
Institutional Source Beutler Lab
Gene Symbol Fut9
Ensembl Gene ENSMUSG00000055373
Gene Name fucosyltransferase 9
Synonyms mFUT9, mFuc-TIX
MMRRC Submission 044937-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6825 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 25609333-25800003 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25619925 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 296 (S296R)
Ref Sequence ENSEMBL: ENSMUSP00000103834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]
AlphaFold O88819
Predicted Effect probably benign
Transcript: ENSMUST00000084770
AA Change: S296R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: S296R

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 6 358 2.9e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108199
AA Change: S296R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: S296R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tran_10_N 61 169 1.4e-43 PFAM
Pfam:Glyco_transf_10 185 357 4.8e-69 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,954,654 (GRCm39) S206T probably benign Het
Aasdh A T 5: 77,036,696 (GRCm39) probably null Het
Adam10 G T 9: 70,668,884 (GRCm39) C400F probably damaging Het
Ankle2 A T 5: 110,398,635 (GRCm39) R561S probably null Het
Arhgef5 C T 6: 43,251,895 (GRCm39) T882I probably damaging Het
Arpc1a A T 5: 145,032,936 (GRCm39) K82* probably null Het
Card11 C A 5: 140,863,837 (GRCm39) R967L probably benign Het
Ccdc82 G T 9: 13,251,601 (GRCm39) probably benign Het
Cebpz T C 17: 79,227,392 (GRCm39) D1026G probably damaging Het
Cit A T 5: 116,119,833 (GRCm39) Q1321L probably damaging Het
Clcn2 C A 16: 20,528,408 (GRCm39) probably benign Het
Csf3 G C 11: 98,593,273 (GRCm39) G130A probably damaging Het
Cul2 T A 18: 3,434,946 (GRCm39) S737T probably damaging Het
Cyp1a2 G A 9: 57,584,543 (GRCm39) H504Y probably benign Het
Cyp3a44 G A 5: 145,716,396 (GRCm39) P398L probably damaging Het
Dnah8 T C 17: 30,960,147 (GRCm39) I2206T probably damaging Het
Efr3a G A 15: 65,701,679 (GRCm39) V198I probably benign Het
Epb41l5 A T 1: 119,547,931 (GRCm39) D157E possibly damaging Het
Ercc8 T C 13: 108,295,343 (GRCm39) S6P probably damaging Het
Faxc T C 4: 21,931,672 (GRCm39) S37P probably benign Het
Fbxl19 T A 7: 127,349,187 (GRCm39) I119K probably damaging Het
Frmd4b A G 6: 97,302,437 (GRCm39) V195A possibly damaging Het
Gas6 T C 8: 13,533,674 (GRCm39) N112D probably benign Het
H2-Q1 T C 17: 35,540,028 (GRCm39) L99P probably damaging Het
Helq A T 5: 100,940,561 (GRCm39) I346N probably damaging Het
Hepacam A G 9: 37,278,976 (GRCm39) K2E possibly damaging Het
Itgae T C 11: 73,009,322 (GRCm39) M502T possibly damaging Het
Kmt2a G A 9: 44,729,704 (GRCm39) probably benign Het
Lhx9 ACC ACCC 1: 138,769,544 (GRCm39) probably null Het
Macf1 A T 4: 123,277,015 (GRCm39) probably null Het
Mgat4a T A 1: 37,503,515 (GRCm39) K220* probably null Het
Or2t43 T C 11: 58,457,476 (GRCm39) R232G possibly damaging Het
Or4c104 T C 2: 88,586,255 (GRCm39) I255V possibly damaging Het
Or5b3 G A 19: 13,388,514 (GRCm39) V194I probably benign Het
Pex5 A T 6: 124,391,340 (GRCm39) M18K probably damaging Het
Phlda3 T C 1: 135,694,562 (GRCm39) *126Q probably null Het
Plxna1 G T 6: 89,297,597 (GRCm39) D1862E probably benign Het
Pold4 A T 19: 4,282,164 (GRCm39) I7F possibly damaging Het
Prkaa1 A T 15: 5,173,432 (GRCm39) I19F possibly damaging Het
Prl7d1 T G 13: 27,894,125 (GRCm39) E148A probably benign Het
Prr14l A T 5: 32,985,892 (GRCm39) V1201E possibly damaging Het
Rab3gap1 T C 1: 127,858,158 (GRCm39) C510R probably damaging Het
Rhbdf1 C T 11: 32,159,970 (GRCm39) R802H probably damaging Het
Rpl18a A C 8: 71,348,836 (GRCm39) F47V probably damaging Het
Sema5b C A 16: 35,448,377 (GRCm39) probably null Het
Sspo G A 6: 48,442,459 (GRCm39) G1985R probably benign Het
Tcaf2 C T 6: 42,606,452 (GRCm39) A501T probably benign Het
Tcerg1 A G 18: 42,681,542 (GRCm39) D563G probably damaging Het
Tdh G A 14: 63,733,281 (GRCm39) T155M probably damaging Het
Tenm2 T C 11: 35,937,711 (GRCm39) N1654S probably benign Het
Tlr5 A T 1: 182,800,609 (GRCm39) probably benign Het
Tns1 G T 1: 74,041,482 (GRCm39) C136* probably null Het
Tomm5 A T 4: 45,106,443 (GRCm39) probably null Het
Trio A T 15: 27,889,394 (GRCm39) F512I probably damaging Het
Ttll5 A T 12: 85,930,102 (GRCm39) probably null Het
Upp1 T A 11: 9,081,707 (GRCm39) H81Q probably benign Het
Usp42 A G 5: 143,713,562 (GRCm39) S71P probably damaging Het
Vamp5 G A 6: 72,357,424 (GRCm39) probably benign Het
Zap70 A G 1: 36,817,471 (GRCm39) Y238C probably damaging Het
Zfp398 A G 6: 47,843,265 (GRCm39) D307G probably damaging Het
Other mutations in Fut9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Fut9 APN 4 25,620,316 (GRCm39) missense possibly damaging 0.71
IGL01134:Fut9 APN 4 25,620,446 (GRCm39) missense probably benign 0.13
IGL01330:Fut9 APN 4 25,619,791 (GRCm39) missense possibly damaging 0.95
IGL01732:Fut9 APN 4 25,619,867 (GRCm39) missense possibly damaging 0.58
IGL02824:Fut9 APN 4 25,620,037 (GRCm39) missense probably damaging 1.00
ANU74:Fut9 UTSW 4 25,620,802 (GRCm39) missense probably benign 0.25
R0280:Fut9 UTSW 4 25,619,852 (GRCm39) missense probably benign 0.00
R0408:Fut9 UTSW 4 25,620,319 (GRCm39) missense possibly damaging 0.69
R0594:Fut9 UTSW 4 25,620,526 (GRCm39) missense possibly damaging 0.94
R0609:Fut9 UTSW 4 25,620,811 (GRCm39) start codon destroyed probably null 0.98
R0709:Fut9 UTSW 4 25,620,359 (GRCm39) missense probably damaging 1.00
R1567:Fut9 UTSW 4 25,620,344 (GRCm39) missense probably damaging 0.99
R1719:Fut9 UTSW 4 25,619,744 (GRCm39) missense possibly damaging 0.62
R1856:Fut9 UTSW 4 25,620,352 (GRCm39) missense probably damaging 1.00
R2036:Fut9 UTSW 4 25,620,322 (GRCm39) missense probably damaging 1.00
R2165:Fut9 UTSW 4 25,619,734 (GRCm39) makesense probably null
R2165:Fut9 UTSW 4 25,619,733 (GRCm39) makesense probably null
R2332:Fut9 UTSW 4 25,619,823 (GRCm39) nonsense probably null
R4539:Fut9 UTSW 4 25,619,793 (GRCm39) missense probably damaging 1.00
R4722:Fut9 UTSW 4 25,799,734 (GRCm39) utr 5 prime probably benign
R4766:Fut9 UTSW 4 25,799,191 (GRCm39) intron probably benign
R4937:Fut9 UTSW 4 25,799,591 (GRCm39) splice site probably benign
R5025:Fut9 UTSW 4 25,620,502 (GRCm39) missense probably damaging 1.00
R5032:Fut9 UTSW 4 25,799,245 (GRCm39) intron probably benign
R5158:Fut9 UTSW 4 25,620,731 (GRCm39) missense probably benign 0.01
R5601:Fut9 UTSW 4 25,620,299 (GRCm39) missense probably benign 0.00
R5974:Fut9 UTSW 4 25,620,090 (GRCm39) nonsense probably null
R6315:Fut9 UTSW 4 25,619,774 (GRCm39) missense probably damaging 1.00
R6385:Fut9 UTSW 4 25,620,328 (GRCm39) missense probably damaging 1.00
R6652:Fut9 UTSW 4 25,620,619 (GRCm39) missense probably benign 0.44
R6809:Fut9 UTSW 4 25,620,647 (GRCm39) missense probably benign
R7145:Fut9 UTSW 4 25,620,507 (GRCm39) missense probably damaging 0.96
R7573:Fut9 UTSW 4 25,620,691 (GRCm39) missense probably benign 0.04
R8933:Fut9 UTSW 4 25,619,861 (GRCm39) missense probably damaging 1.00
R9715:Fut9 UTSW 4 25,620,679 (GRCm39) missense probably benign 0.00
X0057:Fut9 UTSW 4 25,799,686 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- CACTGTGACAATGATGGACAC -3'
(R):5'- ACCTATGGCCAAGCATTCG -3'

Sequencing Primer
(F):5'- GTGACAATGATGGACACTTTAATTCC -3'
(R):5'- CGTGAACGATAAAAATCTGATTCCC -3'
Posted On 2018-09-12