Incidental Mutation 'R6825:Fut9'
ID 534089
Institutional Source Beutler Lab
Gene Symbol Fut9
Ensembl Gene ENSMUSG00000055373
Gene Name fucosyltransferase 9
Synonyms mFuc-TIX, mFUT9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6825 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 25609332-25800244 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25619925 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 296 (S296R)
Ref Sequence ENSEMBL: ENSMUSP00000103834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]
AlphaFold O88819
Predicted Effect probably benign
Transcript: ENSMUST00000084770
AA Change: S296R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: S296R

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 6 358 2.9e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108199
AA Change: S296R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: S296R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tran_10_N 61 169 1.4e-43 PFAM
Pfam:Glyco_transf_10 185 357 4.8e-69 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,907,880 S206T probably benign Het
Aasdh A T 5: 76,888,849 probably null Het
Adam10 G T 9: 70,761,602 C400F probably damaging Het
Ankle2 A T 5: 110,250,769 R561S probably null Het
Arhgef5 C T 6: 43,274,961 T882I probably damaging Het
Arpc1a A T 5: 145,096,126 K82* probably null Het
Card11 C A 5: 140,878,082 R967L probably benign Het
Ccdc82 G T 9: 13,251,976 probably benign Het
Cebpz T C 17: 78,919,963 D1026G probably damaging Het
Cit A T 5: 115,981,774 Q1321L probably damaging Het
Clcn2 C A 16: 20,709,658 probably benign Het
Csf3 G C 11: 98,702,447 G130A probably damaging Het
Cul2 T A 18: 3,434,946 S737T probably damaging Het
Cyp1a2 G A 9: 57,677,260 H504Y probably benign Het
Cyp3a44 G A 5: 145,779,586 P398L probably damaging Het
Dnah8 T C 17: 30,741,173 I2206T probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Epb41l5 A T 1: 119,620,201 D157E possibly damaging Het
Ercc8 T C 13: 108,158,809 S6P probably damaging Het
Faxc T C 4: 21,931,672 S37P probably benign Het
Fbxl19 T A 7: 127,750,015 I119K probably damaging Het
Frmd4b A G 6: 97,325,476 V195A possibly damaging Het
Gas6 T C 8: 13,483,674 N112D probably benign Het
H2-Q1 T C 17: 35,321,052 L99P probably damaging Het
Helq A T 5: 100,792,695 I346N probably damaging Het
Hepacam A G 9: 37,367,680 K2E possibly damaging Het
Itgae T C 11: 73,118,496 M502T possibly damaging Het
Kmt2a G A 9: 44,818,407 probably benign Het
Lhx9 ACC ACCC 1: 138,841,806 probably null Het
Macf1 A T 4: 123,383,222 probably null Het
Mgat4a T A 1: 37,464,434 K220* probably null Het
Olfr1199 T C 2: 88,755,911 I255V possibly damaging Het
Olfr1469 G A 19: 13,411,150 V194I probably benign Het
Olfr224 T C 11: 58,566,650 R232G possibly damaging Het
Pex5 A T 6: 124,414,381 M18K probably damaging Het
Phlda3 T C 1: 135,766,824 *126Q probably null Het
Plxna1 G T 6: 89,320,615 D1862E probably benign Het
Pold4 A T 19: 4,232,110 I7F possibly damaging Het
Prkaa1 A T 15: 5,143,950 I19F possibly damaging Het
Prl7d1 T G 13: 27,710,142 E148A probably benign Het
Prr14l A T 5: 32,828,548 V1201E possibly damaging Het
Rab3gap1 T C 1: 127,930,421 C510R probably damaging Het
Rhbdf1 C T 11: 32,209,970 R802H probably damaging Het
Rpl18a A C 8: 70,896,192 F47V probably damaging Het
Sema5b C A 16: 35,628,007 probably null Het
Sspo G A 6: 48,465,525 G1985R probably benign Het
Tcaf2 C T 6: 42,629,518 A501T probably benign Het
Tcerg1 A G 18: 42,548,477 D563G probably damaging Het
Tdh G A 14: 63,495,832 T155M probably damaging Het
Tenm2 T C 11: 36,046,884 N1654S probably benign Het
Tlr5 A T 1: 182,973,044 probably benign Het
Tns1 G T 1: 74,002,323 C136* probably null Het
Tomm5 A T 4: 45,106,443 probably null Het
Trio A T 15: 27,889,308 F512I probably damaging Het
Ttll5 A T 12: 85,883,328 probably null Het
Upp1 T A 11: 9,131,707 H81Q probably benign Het
Usp42 A G 5: 143,727,807 S71P probably damaging Het
Vamp5 G A 6: 72,380,441 probably benign Het
Zap70 A G 1: 36,778,390 Y238C probably damaging Het
Zfp398 A G 6: 47,866,331 D307G probably damaging Het
Other mutations in Fut9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Fut9 APN 4 25620316 missense possibly damaging 0.71
IGL01134:Fut9 APN 4 25620446 missense probably benign 0.13
IGL01330:Fut9 APN 4 25619791 missense possibly damaging 0.95
IGL01732:Fut9 APN 4 25619867 missense possibly damaging 0.58
IGL02824:Fut9 APN 4 25620037 missense probably damaging 1.00
ANU74:Fut9 UTSW 4 25620802 missense probably benign 0.25
R0280:Fut9 UTSW 4 25619852 missense probably benign 0.00
R0408:Fut9 UTSW 4 25620319 missense possibly damaging 0.69
R0594:Fut9 UTSW 4 25620526 missense possibly damaging 0.94
R0609:Fut9 UTSW 4 25620811 start codon destroyed probably null 0.98
R0709:Fut9 UTSW 4 25620359 missense probably damaging 1.00
R1567:Fut9 UTSW 4 25620344 missense probably damaging 0.99
R1719:Fut9 UTSW 4 25619744 missense possibly damaging 0.62
R1856:Fut9 UTSW 4 25620352 missense probably damaging 1.00
R2036:Fut9 UTSW 4 25620322 missense probably damaging 1.00
R2165:Fut9 UTSW 4 25619733 makesense probably null
R2165:Fut9 UTSW 4 25619734 makesense probably null
R2332:Fut9 UTSW 4 25619823 nonsense probably null
R4539:Fut9 UTSW 4 25619793 missense probably damaging 1.00
R4722:Fut9 UTSW 4 25799734 utr 5 prime probably benign
R4766:Fut9 UTSW 4 25799191 intron probably benign
R4937:Fut9 UTSW 4 25799591 splice site probably benign
R5025:Fut9 UTSW 4 25620502 missense probably damaging 1.00
R5032:Fut9 UTSW 4 25799245 intron probably benign
R5158:Fut9 UTSW 4 25620731 missense probably benign 0.01
R5601:Fut9 UTSW 4 25620299 missense probably benign 0.00
R5974:Fut9 UTSW 4 25620090 nonsense probably null
R6315:Fut9 UTSW 4 25619774 missense probably damaging 1.00
R6385:Fut9 UTSW 4 25620328 missense probably damaging 1.00
R6652:Fut9 UTSW 4 25620619 missense probably benign 0.44
R6809:Fut9 UTSW 4 25620647 missense probably benign
R7145:Fut9 UTSW 4 25620507 missense probably damaging 0.96
R7573:Fut9 UTSW 4 25620691 missense probably benign 0.04
R8933:Fut9 UTSW 4 25619861 missense probably damaging 1.00
R9715:Fut9 UTSW 4 25620679 missense probably benign 0.00
X0057:Fut9 UTSW 4 25799686 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CACTGTGACAATGATGGACAC -3'
(R):5'- ACCTATGGCCAAGCATTCG -3'

Sequencing Primer
(F):5'- GTGACAATGATGGACACTTTAATTCC -3'
(R):5'- CGTGAACGATAAAAATCTGATTCCC -3'
Posted On 2018-09-12