Mutagenetix > Incidental Mutation

Incidental Mutation 'R6825:Arhgef5'

534101

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6825 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 43274961 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 882 (T882I)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: T882I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: T882I

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930447C04Rik	A	T	12: 72,907,880	S206T	probably benign	Het
Aasdh	A	T	5: 76,888,849		probably null	Het
Adam10	G	T	9: 70,761,602	C400F	probably damaging	Het
Ankle2	A	T	5: 110,250,769	R561S	probably null	Het
Arpc1a	A	T	5: 145,096,126	K82*	probably null	Het
Card11	C	A	5: 140,878,082	R967L	probably benign	Het
Ccdc82	G	T	9: 13,251,976		probably benign	Het
Cebpz	T	C	17: 78,919,963	D1026G	probably damaging	Het
Cit	A	T	5: 115,981,774	Q1321L	probably damaging	Het
Clcn2	C	A	16: 20,709,658		probably benign	Het
Csf3	G	C	11: 98,702,447	G130A	probably damaging	Het
Cul2	T	A	18: 3,434,946	S737T	probably damaging	Het
Cyp1a2	G	A	9: 57,677,260	H504Y	probably benign	Het
Cyp3a44	G	A	5: 145,779,586	P398L	probably damaging	Het
Dnah8	T	C	17: 30,741,173	I2206T	probably damaging	Het
Efr3a	G	A	15: 65,829,830	V198I	probably benign	Het
Epb41l5	A	T	1: 119,620,201	D157E	possibly damaging	Het
Ercc8	T	C	13: 108,158,809	S6P	probably damaging	Het
Faxc	T	C	4: 21,931,672	S37P	probably benign	Het
Fbxl19	T	A	7: 127,750,015	I119K	probably damaging	Het
Frmd4b	A	G	6: 97,325,476	V195A	possibly damaging	Het
Fut9	A	T	4: 25,619,925	S296R	probably benign	Het
Gas6	T	C	8: 13,483,674	N112D	probably benign	Het
H2-Q1	T	C	17: 35,321,052	L99P	probably damaging	Het
Helq	A	T	5: 100,792,695	I346N	probably damaging	Het
Hepacam	A	G	9: 37,367,680	K2E	possibly damaging	Het
Itgae	T	C	11: 73,118,496	M502T	possibly damaging	Het
Kmt2a	G	A	9: 44,818,407		probably benign	Het
Lhx9	ACC	ACCC	1: 138,841,806		probably null	Het
Macf1	A	T	4: 123,383,222		probably null	Het
Mgat4a	T	A	1: 37,464,434	K220*	probably null	Het
Olfr1199	T	C	2: 88,755,911	I255V	possibly damaging	Het
Olfr1469	G	A	19: 13,411,150	V194I	probably benign	Het
Olfr224	T	C	11: 58,566,650	R232G	possibly damaging	Het
Pex5	A	T	6: 124,414,381	M18K	probably damaging	Het
Phlda3	T	C	1: 135,766,824	*126Q	probably null	Het
Plxna1	G	T	6: 89,320,615	D1862E	probably benign	Het
Pold4	A	T	19: 4,232,110	I7F	possibly damaging	Het
Prkaa1	A	T	15: 5,143,950	I19F	possibly damaging	Het
Prl7d1	T	G	13: 27,710,142	E148A	probably benign	Het
Prr14l	A	T	5: 32,828,548	V1201E	possibly damaging	Het
Rab3gap1	T	C	1: 127,930,421	C510R	probably damaging	Het
Rhbdf1	C	T	11: 32,209,970	R802H	probably damaging	Het
Rpl18a	A	C	8: 70,896,192	F47V	probably damaging	Het
Sema5b	C	A	16: 35,628,007		probably null	Het
Sspo	G	A	6: 48,465,525	G1985R	probably benign	Het
Tcaf2	C	T	6: 42,629,518	A501T	probably benign	Het
Tcerg1	A	G	18: 42,548,477	D563G	probably damaging	Het
Tdh	G	A	14: 63,495,832	T155M	probably damaging	Het
Tenm2	T	C	11: 36,046,884	N1654S	probably benign	Het
Tlr5	A	T	1: 182,973,044		probably benign	Het
Tns1	G	T	1: 74,002,323	C136*	probably null	Het
Tomm5	A	T	4: 45,106,443		probably null	Het
Trio	A	T	15: 27,889,308	F512I	probably damaging	Het
Ttll5	A	T	12: 85,883,328		probably null	Het
Upp1	T	A	11: 9,131,707	H81Q	probably benign	Het
Usp42	A	G	5: 143,727,807	S71P	probably damaging	Het
Vamp5	G	A	6: 72,380,441		probably benign	Het
Zap70	A	G	1: 36,778,390	Y238C	probably damaging	Het
Zfp398	A	G	6: 47,866,331	D307G	probably damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGGATGTATAGGCCTCTACCCC -3'
(R):5'- ATGATCCTCTCACTGGTGGCTC -3'

Sequencing Primer
(F):5'- ATGTATAGGCCTCTACCCCCAGTC -3'
(R):5'- AGACTCTTCAGTGAGCCCTGAC -3'

Posted On

2018-09-12