Incidental Mutation 'R6825:Arhgef5'
ID 534101
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor 5
Synonyms 2210412D05Rik
MMRRC Submission 044937-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6825 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 43242578-43266254 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43251895 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 882 (T882I)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: T882I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: T882I

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A T 12: 72,954,654 (GRCm39) S206T probably benign Het
Aasdh A T 5: 77,036,696 (GRCm39) probably null Het
Adam10 G T 9: 70,668,884 (GRCm39) C400F probably damaging Het
Ankle2 A T 5: 110,398,635 (GRCm39) R561S probably null Het
Arpc1a A T 5: 145,032,936 (GRCm39) K82* probably null Het
Card11 C A 5: 140,863,837 (GRCm39) R967L probably benign Het
Ccdc82 G T 9: 13,251,601 (GRCm39) probably benign Het
Cebpz T C 17: 79,227,392 (GRCm39) D1026G probably damaging Het
Cit A T 5: 116,119,833 (GRCm39) Q1321L probably damaging Het
Clcn2 C A 16: 20,528,408 (GRCm39) probably benign Het
Csf3 G C 11: 98,593,273 (GRCm39) G130A probably damaging Het
Cul2 T A 18: 3,434,946 (GRCm39) S737T probably damaging Het
Cyp1a2 G A 9: 57,584,543 (GRCm39) H504Y probably benign Het
Cyp3a44 G A 5: 145,716,396 (GRCm39) P398L probably damaging Het
Dnah8 T C 17: 30,960,147 (GRCm39) I2206T probably damaging Het
Efr3a G A 15: 65,701,679 (GRCm39) V198I probably benign Het
Epb41l5 A T 1: 119,547,931 (GRCm39) D157E possibly damaging Het
Ercc8 T C 13: 108,295,343 (GRCm39) S6P probably damaging Het
Faxc T C 4: 21,931,672 (GRCm39) S37P probably benign Het
Fbxl19 T A 7: 127,349,187 (GRCm39) I119K probably damaging Het
Frmd4b A G 6: 97,302,437 (GRCm39) V195A possibly damaging Het
Fut9 A T 4: 25,619,925 (GRCm39) S296R probably benign Het
Gas6 T C 8: 13,533,674 (GRCm39) N112D probably benign Het
H2-Q1 T C 17: 35,540,028 (GRCm39) L99P probably damaging Het
Helq A T 5: 100,940,561 (GRCm39) I346N probably damaging Het
Hepacam A G 9: 37,278,976 (GRCm39) K2E possibly damaging Het
Itgae T C 11: 73,009,322 (GRCm39) M502T possibly damaging Het
Kmt2a G A 9: 44,729,704 (GRCm39) probably benign Het
Lhx9 ACC ACCC 1: 138,769,544 (GRCm39) probably null Het
Macf1 A T 4: 123,277,015 (GRCm39) probably null Het
Mgat4a T A 1: 37,503,515 (GRCm39) K220* probably null Het
Or2t43 T C 11: 58,457,476 (GRCm39) R232G possibly damaging Het
Or4c104 T C 2: 88,586,255 (GRCm39) I255V possibly damaging Het
Or5b3 G A 19: 13,388,514 (GRCm39) V194I probably benign Het
Pex5 A T 6: 124,391,340 (GRCm39) M18K probably damaging Het
Phlda3 T C 1: 135,694,562 (GRCm39) *126Q probably null Het
Plxna1 G T 6: 89,297,597 (GRCm39) D1862E probably benign Het
Pold4 A T 19: 4,282,164 (GRCm39) I7F possibly damaging Het
Prkaa1 A T 15: 5,173,432 (GRCm39) I19F possibly damaging Het
Prl7d1 T G 13: 27,894,125 (GRCm39) E148A probably benign Het
Prr14l A T 5: 32,985,892 (GRCm39) V1201E possibly damaging Het
Rab3gap1 T C 1: 127,858,158 (GRCm39) C510R probably damaging Het
Rhbdf1 C T 11: 32,159,970 (GRCm39) R802H probably damaging Het
Rpl18a A C 8: 71,348,836 (GRCm39) F47V probably damaging Het
Sema5b C A 16: 35,448,377 (GRCm39) probably null Het
Sspo G A 6: 48,442,459 (GRCm39) G1985R probably benign Het
Tcaf2 C T 6: 42,606,452 (GRCm39) A501T probably benign Het
Tcerg1 A G 18: 42,681,542 (GRCm39) D563G probably damaging Het
Tdh G A 14: 63,733,281 (GRCm39) T155M probably damaging Het
Tenm2 T C 11: 35,937,711 (GRCm39) N1654S probably benign Het
Tlr5 A T 1: 182,800,609 (GRCm39) probably benign Het
Tns1 G T 1: 74,041,482 (GRCm39) C136* probably null Het
Tomm5 A T 4: 45,106,443 (GRCm39) probably null Het
Trio A T 15: 27,889,394 (GRCm39) F512I probably damaging Het
Ttll5 A T 12: 85,930,102 (GRCm39) probably null Het
Upp1 T A 11: 9,081,707 (GRCm39) H81Q probably benign Het
Usp42 A G 5: 143,713,562 (GRCm39) S71P probably damaging Het
Vamp5 G A 6: 72,357,424 (GRCm39) probably benign Het
Zap70 A G 1: 36,817,471 (GRCm39) Y238C probably damaging Het
Zfp398 A G 6: 47,843,265 (GRCm39) D307G probably damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43,257,203 (GRCm39) nonsense probably null
IGL01341:Arhgef5 APN 6 43,260,925 (GRCm39) missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43,250,962 (GRCm39) missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43,251,538 (GRCm39) missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43,249,345 (GRCm39) missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43,252,064 (GRCm39) missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43,260,916 (GRCm39) missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43,249,869 (GRCm39) nonsense probably null
IGL03292:Arhgef5 APN 6 43,257,180 (GRCm39) missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43,250,934 (GRCm39) missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43,257,585 (GRCm39) missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43,242,555 (GRCm39) splice site probably null
R0206:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43,250,330 (GRCm39) missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43,251,568 (GRCm39) missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43,256,449 (GRCm39) missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43,250,337 (GRCm39) missense probably benign
R1663:Arhgef5 UTSW 6 43,253,899 (GRCm39) missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43,257,133 (GRCm39) missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43,265,616 (GRCm39) missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43,260,252 (GRCm39) missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43,251,354 (GRCm39) missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43,250,724 (GRCm39) missense probably benign
R4205:Arhgef5 UTSW 6 43,250,766 (GRCm39) missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43,251,027 (GRCm39) missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43,252,033 (GRCm39) missense probably benign
R4636:Arhgef5 UTSW 6 43,251,876 (GRCm39) missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43,260,117 (GRCm39) missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43,250,484 (GRCm39) missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43,250,148 (GRCm39) missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43,250,634 (GRCm39) missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43,242,614 (GRCm39) start gained probably benign
R5251:Arhgef5 UTSW 6 43,249,815 (GRCm39) missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43,249,273 (GRCm39) missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43,250,997 (GRCm39) missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43,252,874 (GRCm39) missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43,252,038 (GRCm39) missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43,252,068 (GRCm39) missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43,251,966 (GRCm39) missense probably benign 0.01
R6831:Arhgef5 UTSW 6 43,257,933 (GRCm39) missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43,250,232 (GRCm39) missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43,251,351 (GRCm39) missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43,252,276 (GRCm39) missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43,265,665 (GRCm39) missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43,252,142 (GRCm39) missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43,250,166 (GRCm39) nonsense probably null
R7358:Arhgef5 UTSW 6 43,256,507 (GRCm39) missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43,257,216 (GRCm39) missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43,257,605 (GRCm39) nonsense probably null
R7503:Arhgef5 UTSW 6 43,250,933 (GRCm39) missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43,250,728 (GRCm39) missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43,252,069 (GRCm39) nonsense probably null
R7950:Arhgef5 UTSW 6 43,250,859 (GRCm39) missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43,260,885 (GRCm39) missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43,257,579 (GRCm39) missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43,252,933 (GRCm39) critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43,264,558 (GRCm39) missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43,260,940 (GRCm39) missense
R9610:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43,251,736 (GRCm39) missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43,250,527 (GRCm39) missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43,256,407 (GRCm39) missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43,250,635 (GRCm39) missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43,249,342 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGATGTATAGGCCTCTACCCC -3'
(R):5'- ATGATCCTCTCACTGGTGGCTC -3'

Sequencing Primer
(F):5'- ATGTATAGGCCTCTACCCCCAGTC -3'
(R):5'- AGACTCTTCAGTGAGCCCTGAC -3'
Posted On 2018-09-12